ID: 1100649799

View in Genome Browser
Species Human (GRCh38)
Location 12:96572971-96572993
Sequence CACTGAATCAGGAACTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100649799 Original CRISPR CACTGAATCAGGAACTACCA AGG Intronic
900934873 1:5758924-5758946 CTCTGAGGCAGGAACTCCCAGGG - Intergenic
903453816 1:23473245-23473267 CACTGAATCAGAATCTCCCAGGG - Intronic
904670375 1:32160407-32160429 TGCTGAACCAGGAACTCCCAGGG + Intronic
904974057 1:34442508-34442530 CACTGAATCAGAAACTCAGACGG - Intergenic
905149453 1:35915867-35915889 CACTGAATCAGAAACTCTAAGGG - Intronic
905826990 1:41033330-41033352 CACTGTGGCATGAACTACCAGGG + Intronic
907952570 1:59197772-59197794 CACTGAATCAGAAACTCTGAGGG - Intergenic
912990936 1:114485602-114485624 CACTTCATCAGGAAGGACCAAGG + Intronic
914985080 1:152449598-152449620 CACTGGATCAGGAACAAGCCAGG - Intergenic
918930422 1:190848129-190848151 CACTGCATCAGGAAATTACAAGG - Intergenic
919165766 1:193889411-193889433 CACTGAAACAAGTACTGCCAGGG - Intergenic
919643496 1:200067889-200067911 CTCAGAATCAGGAACTTCAAGGG - Intronic
921428507 1:215034022-215034044 CACTGGAGCAGAAACCACCAAGG - Intronic
921827728 1:219692740-219692762 CACTGAATCAGAAACTCTGAGGG - Intronic
924522097 1:244814374-244814396 CACGGTGTCAGGAACTCCCAAGG - Intergenic
1063890522 10:10623543-10623565 CACTGCAGCAGGAGCTGCCATGG + Intergenic
1064584661 10:16828200-16828222 CACTGAATCGGGATTTCCCAGGG - Intronic
1065059137 10:21879986-21880008 CACTGATAAAGGAACTAGCAGGG - Intronic
1067791659 10:49292957-49292979 CACTGAAGCAGGAACTCTGAGGG + Intergenic
1068543546 10:58322695-58322717 CACAGAAACAGGAAGTACAATGG - Intergenic
1070843261 10:79502741-79502763 CCCTGAAGCAGGGACTTCCAGGG - Intergenic
1072777531 10:98214295-98214317 CACTGAAACAAGCACTGCCAAGG - Intronic
1075467364 10:122661857-122661879 CAGAGAATCAGGAACCACCGTGG - Intergenic
1075735306 10:124661197-124661219 CCCTGAATCAGGAGGTTCCAGGG + Intronic
1079428934 11:20370097-20370119 GACTGCATCAGGATCTCCCAAGG - Intronic
1082842831 11:57703028-57703050 CACTGATTCAGGAACAACCTTGG + Intergenic
1084751897 11:71209505-71209527 CTCAGAATCAGGAACAGCCATGG + Intronic
1087968083 11:104443555-104443577 CACTGAATCAAGAACTCCATTGG - Intergenic
1088089384 11:106020881-106020903 CACTTAATCAGAAAATATCAAGG - Intronic
1088593952 11:111425953-111425975 CACTGAATCCTCAACTTCCAGGG - Intronic
1089049013 11:115529644-115529666 ACCCGAATCAGGAACTACCAGGG + Intergenic
1090278819 11:125438872-125438894 TACTGAATCAGAAACTCACAGGG + Intergenic
1090464222 11:126919447-126919469 CACTGCAGCCAGAACTACCAAGG - Intronic
1093218433 12:16389847-16389869 CACTGGATCAGGTGCTCCCAAGG + Intronic
1095505061 12:42887946-42887968 CACAGAATCAGGAATTAAAATGG - Intergenic
1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG + Intronic
1097040190 12:56151824-56151846 CACTGGATCAGTAAATACCCTGG - Intergenic
1097816380 12:64079236-64079258 GACTGAATCAGGAACTCTGATGG - Intronic
1098976473 12:76907498-76907520 CACTGAATCATGCACTCACAAGG - Intergenic
1099660495 12:85552634-85552656 TACTGAATCAGAAACTTGCAGGG - Intergenic
1100649799 12:96572971-96572993 CACTGAATCAGGAACTACCAAGG + Intronic
1106891051 13:34245952-34245974 CACTGAAGAAGGAACTAATAAGG - Intergenic
1107162329 13:37245197-37245219 CACTTTTTTAGGAACTACCATGG + Intergenic
1108474730 13:50802578-50802600 CATTGAAACAAGAACAACCATGG - Intronic
1109765546 13:66891117-66891139 CACTGACACAGGCAATACCATGG - Intronic
1111275298 13:85938779-85938801 GACTGAATCAGGAAATAGAAAGG - Intergenic
1112996281 13:105578273-105578295 AACTGAATCTGGGGCTACCAAGG + Intergenic
1114426789 14:22630613-22630635 CACTGACTCAGAAACTCCGAAGG + Intergenic
1119433561 14:74583823-74583845 CACTGGACCAGGAGCTACCCGGG - Intronic
1119916068 14:78403429-78403451 CACTGACTCAGGAAGTCACATGG - Intronic
1121805093 14:96811576-96811598 GAGTGAGTCAGGAACTACCCTGG + Intronic
1122519683 14:102334545-102334567 CACTGCTGGAGGAACTACCAAGG - Exonic
1122759461 14:104011559-104011581 GAATGGATCAGTAACTACCAGGG - Intronic
1122971180 14:105152853-105152875 TGCAGAATCAGGAACTACCCTGG - Intronic
1133379443 16:5317657-5317679 CACTGAATGAGGCACTTTCAGGG - Intergenic
1137508348 16:49076324-49076346 TACTGAATCAGCATCTTCCAAGG - Intergenic
1139154133 16:64420509-64420531 CACTGAATCAGAATCTCCTAGGG + Intergenic
1139184527 16:64790154-64790176 TACTGAATCAGAAACAACTATGG - Intergenic
1140299169 16:73739563-73739585 CATGGAAGCAGGAACAACCAAGG - Intergenic
1143341044 17:6211148-6211170 ATCTGAATAATGAACTACCATGG + Intergenic
1144539322 17:16123867-16123889 TACTAAATCATGAACTACCTGGG + Intronic
1147233828 17:39041567-39041589 AACTGAATCAGTAACTGCGAGGG - Intergenic
1148173187 17:45541044-45541066 AACTGAATCAGTAACTACGAGGG + Intergenic
1148276080 17:46304407-46304429 AACTGAATCAGTAACTACGAGGG - Intronic
1148298198 17:46521983-46522005 AACTGAATCAGTAACTACGAGGG - Intronic
1148362738 17:47026453-47026475 AACTGAATCAGTAACTACGAGGG - Intronic
1150404393 17:64887961-64887983 AACTGAATCAGTAACTACGAGGG + Intronic
1152841299 17:82570415-82570437 CACTGAAGCCTGAACTCCCAGGG - Intronic
1153576744 18:6529456-6529478 GACTGAATCAGAAACGACAAAGG - Intronic
1155213288 18:23620762-23620784 CACTGACTCTGAAACTCCCACGG - Intronic
1156948853 18:42868827-42868849 CACAGAATCAGGAACCTCAATGG + Intronic
1158332761 18:56380844-56380866 CACTGAAGCAGGAAGTAGAATGG + Intergenic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1160779168 19:870254-870276 CACACAATCAGGAAACACCAAGG + Intronic
1161143786 19:2664956-2664978 CCCTGAATTAGGAAATTCCACGG + Intronic
1162455700 19:10783110-10783132 CGCTGAATCAGGTACTGCAAGGG + Exonic
1162918880 19:13888870-13888892 CACTGAAGCAGAAGCTGCCAGGG + Intronic
1166937647 19:46344159-46344181 CACAGAATCAGAAAGTAACATGG - Intergenic
925824229 2:7831450-7831472 CACTGACTCAGGAACTTGGAAGG + Intergenic
926482207 2:13413439-13413461 CATTCAATCAGGAAATACTATGG + Intergenic
927108883 2:19850237-19850259 CACTGACTCAGCCACTACCTGGG - Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932809862 2:74816069-74816091 CACTGAAGCAGGAAATATCTTGG - Intergenic
933849777 2:86356541-86356563 CACTGAAGCAGAAACATCCAGGG + Intergenic
936531772 2:113281178-113281200 CAGAGAATTAGGAAGTACCAAGG - Intergenic
937290391 2:120778372-120778394 GACTGAATCAGGAGCGACGATGG - Intronic
937647803 2:124285200-124285222 CACTGACTCAGGCATTACAAAGG - Intronic
938410997 2:131064443-131064465 CACTCAATCAGGCACCAACAAGG + Intronic
938920884 2:135993549-135993571 TACTGAATCAGAAACTCTCAGGG + Intergenic
940558350 2:155261879-155261901 AATTGGATCAGAAACTACCATGG - Intergenic
941288297 2:163642714-163642736 CAATTAATGAGGACCTACCATGG - Intronic
943903895 2:193473964-193473986 CTCTTAACCAGGAACAACCAGGG + Intergenic
945350077 2:208767014-208767036 CACTGAATCAGGATCTCTGAGGG + Intronic
945787401 2:214259300-214259322 CACTGAATCAGGAATGCACAAGG - Intronic
945929446 2:215840437-215840459 GACTGAATCAGGAACTCTGAGGG + Intergenic
946483397 2:220077971-220077993 CACCAAATCAGCAATTACCATGG + Intergenic
946592434 2:221265329-221265351 CACTAAATCAGGAACTCTGAGGG + Intergenic
1168806982 20:677226-677248 CACTGAATCAGGGCCTATCATGG + Intergenic
1169353104 20:4885938-4885960 CACGGCATCGGGAACTACCGAGG + Intronic
1170884387 20:20327376-20327398 AACTAAATCAGGAACTTCGAAGG + Intronic
1171390369 20:24797912-24797934 CACTGAATCAGGAACTCTGGAGG + Intergenic
1175101850 20:56584888-56584910 CACTGAATCAGAAACTCTAAGGG + Intergenic
1177158695 21:17524459-17524481 GGCTGAATCAGGAGCTACCCAGG + Intronic
1184749830 22:46478955-46478977 CAGGGAGTCAGGAACGACCAGGG + Intronic
1185075657 22:48680714-48680736 CACTGGACCAGGACCTCCCACGG - Intronic
949383998 3:3479541-3479563 CACTGTACCAGGGACTACCGGGG + Intergenic
950769016 3:15296090-15296112 CACTGAATTAGCAAGTACCAAGG - Intronic
954286492 3:49623225-49623247 CACTGAGGCAGCAGCTACCAGGG + Intronic
954899760 3:54008707-54008729 CACTGATTCAACAACTGCCAGGG + Intergenic
956408721 3:68956009-68956031 TATAGACTCAGGAACTACCACGG + Intergenic
957963974 3:87297890-87297912 CACAGACTCAGGAAATACAATGG + Intergenic
958913320 3:100020011-100020033 CACTGATTCAGTAATTACCCTGG + Intronic
962181230 3:133208176-133208198 CACTGAATCAGAAACTCTAAGGG - Intronic
964745326 3:160006942-160006964 TACTGAATAAGAAACTACCAGGG + Intergenic
967095074 3:186171096-186171118 CACAGAAGAAGGAACTAGCATGG - Intronic
970702972 4:18764664-18764686 TACTGAATCAGAAACAAGCATGG + Intergenic
971610232 4:28714618-28714640 GACGGAATCAGGAACTCTCAGGG + Intergenic
975503581 4:75114442-75114464 CACTGAATCAGTAATTACTTTGG - Intergenic
977336104 4:95701553-95701575 CACTGGGTCAGGAACTAACAAGG - Intergenic
977503492 4:97872185-97872207 CACTCAATCAGGAAGTGCTAGGG + Intronic
978803375 4:112775935-112775957 GACTGAATCAGAAACTCCAAGGG - Intergenic
983216394 4:165006778-165006800 CAATGAAGCAGGAAGTCCCAGGG - Intergenic
983941103 4:173534867-173534889 CACTGAATCTGCAACTGGCATGG + Intergenic
984489750 4:180417983-180418005 CACTGAATCAGAAACTCTGAGGG + Intergenic
988824600 5:34922765-34922787 CACTGAATGAGAAACTTACAGGG - Exonic
992886486 5:81165259-81165281 TCCTGACTCAGGAAATACCAAGG + Intronic
995345094 5:111104566-111104588 CACTGACTCTGGAGCTACAAGGG - Intronic
996337405 5:122399878-122399900 TACTGAATCAGGAACTCTGAGGG - Intronic
997267770 5:132506124-132506146 CAGGGAATCAGAAAGTACCAGGG + Intergenic
997753902 5:136376422-136376444 CACTGAATCGCAAACTAGCAAGG + Intronic
999535937 5:152517660-152517682 TACTGAATCAGTTATTACCAGGG + Intergenic
1005873796 6:29996252-29996274 CAGTGAACCAGGAGCTACAAGGG - Intergenic
1006251922 6:32794810-32794832 TACTGTAACAGGAACTATCATGG - Intergenic
1006264812 6:32911754-32911776 CACTGAAAGAGGAAATACAAGGG - Intergenic
1006858805 6:37155535-37155557 CACTGAATCAGAAACTCCGGGGG - Intergenic
1009595370 6:65728808-65728830 CACTGATGCTGGCACTACCAAGG + Intergenic
1011984548 6:93427102-93427124 CAATGTATCAGTAACTAACAAGG - Intergenic
1012582667 6:100888118-100888140 CTCTGAAGCAGGAATTACCTTGG - Intergenic
1015319056 6:131850990-131851012 CACAGAATCTGCCACTACCATGG - Intronic
1017548268 6:155475469-155475491 CACTGAATTAGGAAAGAACAGGG - Intergenic
1018199072 6:161378783-161378805 CTCTGAATCAACAACTACCATGG + Intronic
1020672262 7:11131176-11131198 AACTTAGTCAGGAAATACCAAGG + Intronic
1023717195 7:43056344-43056366 CAGTGAAGCAGCAACCACCAGGG - Intergenic
1024037161 7:45516890-45516912 CAGGGAATCAGAAAGTACCAGGG + Intergenic
1028230560 7:88301961-88301983 CACTAAATCAGGAAATACCAAGG + Intronic
1028335179 7:89643760-89643782 CACTGAAATAGGAAATAACATGG - Intergenic
1029993106 7:104980003-104980025 CACTGCATCAGAAACTCCAAAGG - Intergenic
1030170057 7:106591720-106591742 CACTGAATCAGGAACTCTGAGGG + Intergenic
1030714752 7:112794329-112794351 TACTGAATCAGGAACTCTAAGGG + Intergenic
1031071547 7:117167432-117167454 CTCTGAAATAGGAAATACCAAGG + Intronic
1031551671 7:123121741-123121763 CAGTGAAACAGCAACTACTATGG - Intronic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1036720198 8:11167238-11167260 CACTGAATCAAGAACTTCAAAGG + Intronic
1042110001 8:65371001-65371023 CACACAATCAGGAACAACAAAGG + Intergenic
1043661934 8:82754049-82754071 GAATAAATCAGGAGCTACCAAGG - Intergenic
1044822465 8:96163715-96163737 CACTGAAACAGGGACCACAAAGG + Intergenic
1045599055 8:103692931-103692953 CACAGAATCAGGAATTGCCCAGG + Intronic
1047841064 8:128754031-128754053 CACTGAAAGAGGAACTACAGAGG + Intergenic
1050560907 9:6833689-6833711 CACTGATTCAGTACATACCAGGG - Intronic
1053070077 9:35096024-35096046 TACTGAATCAGGATCTTCGAGGG + Intronic
1059182554 9:112231601-112231623 CCCTGGATCAGAAGCTACCATGG + Intronic
1061986459 9:134132917-134132939 CACTGACCCAGGAATTACAATGG + Intergenic
1187012414 X:15293603-15293625 CTCTGAATCATGAACAAACATGG + Intronic
1187577549 X:20574405-20574427 TACTGAATCAGGAACTCTGAGGG + Intergenic
1190913227 X:54790705-54790727 CACTGAATCAGGAAGGAACTTGG + Intronic
1193616019 X:83688888-83688910 GACAGAATCATGAACTACCCTGG - Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1201748986 Y:17412094-17412116 CACCGAATCAAGAAAGACCAAGG - Intergenic