ID: 1100651147

View in Genome Browser
Species Human (GRCh38)
Location 12:96590279-96590301
Sequence CACCATTGGCAACTGCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100651147 Original CRISPR CACCATTGGCAACTGCAAAT AGG Intronic
901162479 1:7189844-7189866 CACAATTTGCAAATGCAAAAAGG + Intronic
902989120 1:20173807-20173829 CACCATTCCCATCTGCAAGTGGG + Intronic
904049544 1:27631016-27631038 CACACTTGGCCACTGCACATCGG - Intronic
906470943 1:46130840-46130862 CACCATCTGTAACTGCAAACAGG + Intronic
908395341 1:63720196-63720218 AACCATAGGCAACTGCAGTTAGG + Intergenic
908497552 1:64709909-64709931 CACCCTTGGCTACAGCAAATTGG + Intergenic
909772995 1:79448599-79448621 CATCCTTGGCTACTGCCAATTGG + Intergenic
911689589 1:100817738-100817760 CACAATTCGCAATTGCAAAAAGG + Intergenic
922116691 1:222619604-222619626 TGCCATTGCCAACGGCAAATGGG - Intronic
923338257 1:232987850-232987872 CACCAGTGCCCTCTGCAAATGGG - Intronic
924396959 1:243630821-243630843 CACCATTGGAAACACCAAATTGG - Intronic
1065155929 10:22870174-22870196 GACCATGGGCAATTGCACATAGG + Intergenic
1067679668 10:48423235-48423257 GACCCTTGCCAACTGTAAATGGG - Intronic
1069057602 10:63860949-63860971 CACCAATGGTAACAGCCAATGGG - Intergenic
1069237752 10:66098973-66098995 CACCAGTGGCAAATGCCAGTAGG - Intronic
1070644177 10:78190044-78190066 CAGCATTCTCATCTGCAAATTGG - Intergenic
1070727787 10:78803864-78803886 CAGCCTTGGCAACTGGAAAGGGG - Intergenic
1070925377 10:80217531-80217553 CACCTTTTCCAACTGCAAAATGG + Intergenic
1078290908 11:10008685-10008707 CAAGCTTGGCAACTGGAAATAGG + Intronic
1080663588 11:34316617-34316639 CACCAGTGGCAACAGCAACTTGG - Intronic
1082285174 11:50310292-50310314 CTCCATTGGCTGCTGCAAACTGG - Intergenic
1082793898 11:57366311-57366333 CACCATAGGCATCTACAAAATGG + Intronic
1085088449 11:73689333-73689355 CACTATTGTGAACTGCACATTGG - Intronic
1086879186 11:92133871-92133893 GACTATTTGTAACTGCAAATTGG - Intergenic
1091697305 12:2636570-2636592 CACCTTTAGCATCAGCAAATTGG - Intronic
1098626549 12:72678178-72678200 AACCATTTGCAACTGGATATAGG + Intergenic
1098810827 12:75088717-75088739 CACCATTGGAAACTGATAAAGGG - Intronic
1099026352 12:77469178-77469200 TACCACTGGGATCTGCAAATTGG - Intergenic
1100651147 12:96590279-96590301 CACCATTGGCAACTGCAAATAGG + Intronic
1106431158 13:29681823-29681845 CATCCTTGCCAACTGCAGATGGG - Intergenic
1108879686 13:55095317-55095339 CACCATGTTCAAGTGCAAATTGG + Intergenic
1110950109 13:81475561-81475583 CATCCTAGGCAACTGCTAATCGG - Intergenic
1112588089 13:100737482-100737504 CTCCATTGGCAGCTCCAGATAGG + Intergenic
1112790716 13:102999782-102999804 AACAATTGCCAACTGCAGATGGG - Intergenic
1112843136 13:103605232-103605254 AACCACTGGAAACTGCAATTAGG - Intergenic
1113359307 13:109614448-109614470 AGCCATTGGCAACAGCATATTGG + Intergenic
1115231046 14:31161263-31161285 CACATTTGGCTAATGCAAATAGG + Intronic
1115825807 14:37272884-37272906 AAACATTGGAAACAGCAAATAGG + Intronic
1117547197 14:56803424-56803446 CATCAGTGTCAGCTGCAAATTGG - Intronic
1124841858 15:33249567-33249589 CACCAGTGGCAAATCCATATGGG - Intergenic
1133713324 16:8422870-8422892 CACCATGGGCCAATGGAAATGGG - Intergenic
1135177546 16:20244028-20244050 CTCCACTGGCAACTCCACATTGG - Intergenic
1137990352 16:53147820-53147842 CACCAAAAGCAACTGAAAATAGG - Intronic
1139467281 16:67160735-67160757 CAGGATTGGCAACTTCAAAGAGG + Intronic
1140117199 16:72052652-72052674 CACCATTGGAAAATGTCAATAGG - Intronic
1140307195 16:73814226-73814248 CACCATTGTCAACTGCCAAATGG + Intergenic
1150511543 17:65757522-65757544 CAGCATTGGCAATTTCAAGTGGG - Intronic
1151084341 17:71363702-71363724 CAAGCTTGGCAAATGCAAATGGG - Intergenic
1155590899 18:27426078-27426100 CAACTTTGGCAAATGCAAATGGG - Intergenic
1157171349 18:45409324-45409346 CACCCTGGGCCACTGAAAATTGG + Intronic
1158914975 18:62115532-62115554 AAATATTGGCAACTGCACATGGG + Intronic
1159338702 18:67105297-67105319 CACAGTTATCAACTGCAAATTGG + Intergenic
1160084931 18:75767886-75767908 CAACATTTACAACTGCAAAAGGG + Intergenic
1162014795 19:7839494-7839516 CACCATTGGGAGCTGCTAAAGGG + Intronic
1164521812 19:28985382-28985404 CACCATTTGCACCAGCAAAGTGG - Intergenic
1164821576 19:31255212-31255234 CACCATTGCCTACTGCAGAGGGG - Intergenic
1166923450 19:46249034-46249056 CACCCTTGGCAACTACCAGTCGG - Intergenic
925860500 2:8170831-8170853 CTCCATTGGCAGCTGGAAAGTGG + Intergenic
926348709 2:11975369-11975391 CAGCATTGGCAGCTGCAGGTGGG + Intergenic
926645765 2:15288365-15288387 GACCATTGTGAACTGCAAGTAGG + Intronic
927458691 2:23278888-23278910 AACCACTGGCAACTCCACATTGG + Intergenic
929168504 2:38907389-38907411 CACCAAAGGCAGCTCCAAATTGG + Intronic
931959958 2:67471357-67471379 CACCATTTTCAAATGCAATTTGG + Intergenic
932949530 2:76276739-76276761 ACCCCTTTGCAACTGCAAATTGG + Intergenic
936369535 2:111892126-111892148 CACCACAGTCAACTGCATATGGG - Intergenic
936746410 2:115581891-115581913 TACCAGTGGCAACTCCATATGGG + Intronic
936795908 2:116204115-116204137 CTCCAGTGGCAACTGCAGCTTGG + Intergenic
938252683 2:129827799-129827821 CACCTTTGGAAAATGTAAATCGG - Intergenic
941486483 2:166088361-166088383 CATCATTGACACCTGAAAATAGG - Intronic
944124420 2:196277225-196277247 TACCATTGGTCCCTGCAAATCGG + Intronic
944199794 2:197094275-197094297 CACCTTTGGCAAGTGCATAACGG + Intronic
945330546 2:208535184-208535206 AACAAATAGCAACTGCAAATGGG - Intronic
947083810 2:226428259-226428281 GACCATTTGCAACTTCAAAGAGG - Intergenic
1171322722 20:24260557-24260579 GACCCTTGGAATCTGCAAATAGG - Intergenic
1171773418 20:29344958-29344980 CCCCATTGGCAACAGCAACTTGG + Intergenic
1171815456 20:29782520-29782542 CCCCATTGGCCACAGCAACTTGG + Intergenic
1171981409 20:31631877-31631899 CACAATTGGCTCCTGCACATGGG - Intergenic
1178041098 21:28641942-28641964 CAACAATGTCTACTGCAAATAGG + Intergenic
1180318906 22:11303086-11303108 CCCCATTGGCAACAGCAACTTGG + Intergenic
1181152450 22:20894633-20894655 CACATTTGGCATCTGCAAGTAGG + Intergenic
1182861472 22:33563124-33563146 CAACAGAGGCAACTGCAAAAAGG + Intronic
953696974 3:45167291-45167313 CACCACTGGCAACTGCAGAATGG - Intergenic
956484382 3:69706608-69706630 GACAATTGTCAACTTCAAATTGG + Intergenic
957850015 3:85795784-85795806 CACCATTTGAAACTTTAAATTGG - Intronic
962003351 3:131323559-131323581 CTCCTTTGGCAACTACAAATGGG - Intronic
962017050 3:131452533-131452555 CACCAGTGAAAACTACAAATGGG + Intergenic
969155359 4:5205281-5205303 CACCATTGTCATCTGCAAGCTGG - Intronic
970151149 4:13091852-13091874 CACAATTTGCAATTGCAAAATGG + Intergenic
973076087 4:45927850-45927872 CACCACTGACAACAGCAGATGGG + Intergenic
975651089 4:76593891-76593913 CAATATTGGAAACTGCAAACAGG - Intronic
975917396 4:79341116-79341138 CACCACTGGGAACTGTAAAATGG + Intergenic
978723540 4:111943884-111943906 ACCTAGTGGCAACTGCAAATGGG - Intergenic
980393278 4:132172866-132172888 CAGCAGTGGCAACTATAAATTGG + Intergenic
980586683 4:134826588-134826610 CACCGTTGGTAACTCGAAATGGG + Intergenic
984126320 4:175815313-175815335 CACCATTAGCAACAACAACTTGG - Intronic
986051394 5:4093786-4093808 CACCACTGACAAATTCAAATAGG - Intergenic
986121585 5:4842502-4842524 CACTTTTGGCATCTGCAAAATGG + Intergenic
989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992426510 5:76663135-76663157 CCCCAGGGGCAACTGGAAATGGG + Intronic
993103797 5:83574976-83574998 CACCATTATTAATTGCAAATAGG - Intronic
993921234 5:93805741-93805763 GACCATGAGCAACTACAAATAGG - Intronic
998657539 5:144198525-144198547 TACCAGTGGCATCTGCAGATGGG - Intronic
1004808683 6:19234196-19234218 TACCATTGCCTATTGCAAATAGG + Intergenic
1007059161 6:38921392-38921414 CAGCATTAGCAACTGCTAACCGG - Exonic
1010886548 6:81250161-81250183 CACAATTTGCAATTGCAAAAAGG - Intergenic
1011400415 6:86955198-86955220 CATGATTGGTAAGTGCAAATGGG - Intronic
1013464731 6:110408371-110408393 CAGAATTGGCAATTGCAAAGAGG + Exonic
1013927277 6:115488320-115488342 CACGATAGGCATCTGCAAGTTGG - Intergenic
1014936037 6:127385954-127385976 TCACATTGGCAACTGGAAATTGG + Intergenic
1016966881 6:149726544-149726566 TAACATTGGCAACTGCCACTAGG + Exonic
1018336944 6:162802543-162802565 AACCAATGGTAACTGGAAATAGG - Intronic
1019201978 6:170324879-170324901 CAACATTTTCAACTACAAATGGG - Intronic
1019984845 7:4648148-4648170 GACCATAGGCCCCTGCAAATTGG - Intergenic
1027954886 7:84865042-84865064 CACTTTTGGCACTTGCAAATTGG - Intergenic
1028344257 7:89760765-89760787 TACCATAGGCTACTGCACATGGG + Intergenic
1031094244 7:117400471-117400493 TAGCATTGGCAAGTGCTAATGGG + Intronic
1032524637 7:132570789-132570811 CAGGATTCGCAACAGCAAATTGG - Intronic
1032641027 7:133768383-133768405 CCCCAGTGTCAACTGCGAATGGG + Intronic
1033733115 7:144197183-144197205 GATCATTGGCAACAGCCAATGGG - Intergenic
1033743968 7:144295749-144295771 GATCATTGGCAACAGCCAATGGG - Intergenic
1033749933 7:144353805-144353827 GATCATTGGCAACAGCCAATGGG + Intergenic
1035777756 8:2202787-2202809 CAGCATTGTCAACTCCAGATTGG + Intergenic
1038189625 8:25308104-25308126 CACTATAAGCAACTGCACATCGG - Intronic
1041427425 8:57738493-57738515 CACCAGTGGCAACAGCGAAGTGG + Intergenic
1048742653 8:137579310-137579332 AAGCAATGGCACCTGCAAATAGG - Intergenic
1050699246 9:8318877-8318899 CCCGATTGGCCACTGAAAATAGG - Intronic
1052301284 9:26955553-26955575 GACAAATGGCCACTGCAAATAGG + Intronic
1059160743 9:112032917-112032939 GACCAAGGGCAACTGCAGATAGG + Intergenic
1060025023 9:120163523-120163545 CAACCTTGGCAACTAAAAATAGG + Intergenic
1203367127 Un_KI270442v1:268836-268858 CCCCATTGGCCACAGCAACTTGG + Intergenic
1186515207 X:10161687-10161709 CACCCCTGGCAGCTGCAACTTGG + Intronic
1188829941 X:34883850-34883872 CACCATTTTCAAATTCAAATTGG - Intergenic
1189345283 X:40236479-40236501 CACTATTCACAACTGCAAAAAGG - Intergenic
1192538175 X:71946365-71946387 GACCATTGGTCACTTCAAATTGG + Intergenic
1193793161 X:85841169-85841191 CAGCAGTGGCAGCTGCAAACTGG - Intergenic
1199790553 X:151151398-151151420 CACCATAAGCAACTGGAAGTTGG - Intergenic
1200114351 X:153763598-153763620 CGCCATGGGCAACTGCAAGCTGG - Intergenic