ID: 1100652541

View in Genome Browser
Species Human (GRCh38)
Location 12:96606149-96606171
Sequence GAGCTGAGCCTATTTTAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100652541 Original CRISPR GAGCTGAGCCTATTTTAGAC GGG Intronic
904802459 1:33103513-33103535 GAGGTGAGCCTACTTTAGAGAGG - Intronic
908975606 1:69894002-69894024 GAGCAGAGCCTATTCAAGAGTGG + Intronic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
911972954 1:104460707-104460729 GAGCTTTGACTATTCTAGACCGG - Intergenic
912457489 1:109807596-109807618 GAGCTGAGACTTTGTTAGCCTGG + Intergenic
920821418 1:209385058-209385080 GTGCTGAGCATATAATAGACAGG + Intergenic
1065257540 10:23886708-23886730 TAGCATAGCCTCTTTTAGACTGG + Intronic
1065987863 10:30974278-30974300 GAGATCAGCCTGTTTAAGACAGG + Intronic
1071333483 10:84583593-84583615 CAGCTGAGCCTTTTGCAGACTGG + Intergenic
1072973918 10:100041214-100041236 GAGCTCAGCCTCAGTTAGACAGG - Intergenic
1076062356 10:127423312-127423334 GAGCTGAGCTTATTATATATCGG - Intronic
1086310559 11:85531633-85531655 GCTCTGAGCCTATCTTTGACAGG + Intronic
1093435160 12:19128446-19128468 GAACTGAGCCCATGTAAGACAGG - Intergenic
1094539380 12:31350493-31350515 CAGCTGGACCTATTTTAGATTGG - Intergenic
1098529415 12:71523539-71523561 GAGCTGATCATATCTGAGACTGG - Intronic
1100321801 12:93501588-93501610 GTTCTGAGCATATTTAAGACAGG + Exonic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1107625679 13:42280744-42280766 GAGCCAAGCCTATTTTAGGGAGG + Intronic
1108136101 13:47362887-47362909 GTGCTGTGCCCATTTTTGACTGG - Intergenic
1111685831 13:91499752-91499774 GAGATGAGGCTGTTTGAGACTGG - Intronic
1114128562 14:19760907-19760929 AATTTGAGGCTATTTTAGACAGG + Intronic
1114969519 14:28007698-28007720 GAGCTGAAAATATTTTAGAATGG + Intergenic
1115256072 14:31403607-31403629 GAGATAAGCCTAGTTAAGACTGG - Intronic
1118118149 14:62804786-62804808 GAGTTGAGCCTAGTTTAGCCTGG + Intronic
1119359644 14:74037591-74037613 GAGCTGAGCCTTTGAAAGACAGG - Intronic
1120231148 14:81843101-81843123 GAGTTGAGGGTATTTTAGGCTGG + Intergenic
1123571504 15:21615168-21615190 AATTTGAGGCTATTTTAGACGGG + Intergenic
1123608123 15:22057759-22057781 AATTTGAGGCTATTTTAGACGGG + Intergenic
1131777793 15:95821423-95821445 GAGCTGAGCATTTTTTACAGAGG + Intergenic
1132137530 15:99357255-99357277 GAGCTGGGCCTATTATAGTGAGG - Intronic
1202980358 15_KI270727v1_random:349557-349579 AATTTGAGGCTATTTTAGACGGG + Intergenic
1132988622 16:2781254-2781276 AAGATGTGGCTATTTTAGACTGG - Intergenic
1133474308 16:6105460-6105482 CATCTTAGCCTATTTAAGACTGG + Intronic
1134388119 16:13793451-13793473 GAGATGAGCCAGTGTTAGACAGG - Intergenic
1146180951 17:30697881-30697903 GAGCTGAGCGTGTTTGAGATGGG - Intergenic
1148218417 17:45846467-45846489 GAGCTCAGCCTCTTCTGGACTGG + Exonic
1153902241 18:9627985-9628007 GAGATGATCCTTGTTTAGACAGG - Intergenic
1155614884 18:27710549-27710571 GAGGTGTGCCTATTTGAGGCTGG + Intergenic
1158473019 18:57755133-57755155 AACCTGAGACTATTTTAGGCTGG - Intronic
1159756698 18:72374666-72374688 GAGCTGAGACTCTTAAAGACAGG - Intergenic
1162977632 19:14217651-14217673 GAGCTGAGCGTGTTTGAGATGGG + Intergenic
1165216420 19:34276969-34276991 GAGGTGACCCTAGATTAGACAGG + Intronic
1168035739 19:53717884-53717906 GACCTAAGCCCATTTTAGCCTGG - Intergenic
936158950 2:110069836-110069858 AATCTGAGCGTATTTAAGACTGG + Intergenic
936185710 2:110301496-110301518 AATCTGAGCGTATTTAAGACTGG - Intergenic
938862912 2:135388778-135388800 GAGCTCATCCTGTTTTAGGCCGG + Intronic
939885733 2:147679701-147679723 AGGCTGAGCCAATTTTAGAGTGG - Intergenic
941655333 2:168137678-168137700 TAGCTCTGCCTAGTTTAGACTGG + Intronic
941852901 2:170201915-170201937 GATATGAGCCTTTTTTAGTCAGG - Intronic
1173055854 20:39612038-39612060 TAACTGAGCCTATTTAAGGCTGG + Intergenic
1182940781 22:34275020-34275042 GAGTGGAGCCTGTTTTAGAGTGG + Intergenic
1184345133 22:43908560-43908582 GAGCTGAGCCCATCTAAGATAGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
954581118 3:51703444-51703466 GAGCTGAGGCTAATTTAGAGTGG + Intronic
955089278 3:55733232-55733254 GAGCTGTGCATCTTTTACACTGG - Intronic
959312042 3:104750990-104751012 GAGATGACCCTATTTTGGAAAGG - Intergenic
960374434 3:116881096-116881118 AAGCTGAGCATATTTTAGCGTGG + Intronic
961413252 3:126738567-126738589 GTGCTGAGCAAATTCTAGACAGG + Intronic
963785634 3:149531685-149531707 GGGGTGAGGCCATTTTAGACAGG - Intronic
968299086 3:197599692-197599714 CACCTGAGCCTTCTTTAGACAGG - Intergenic
971554947 4:28002099-28002121 GAGCTCAGCCTCTTTTTGAGTGG + Intergenic
973760278 4:54109153-54109175 GACCCGAGCCTTTTTTAGGCCGG - Intronic
973924943 4:55727975-55727997 GAACTGAAACTATTTTAGGCAGG - Intergenic
975885820 4:78963535-78963557 AAGCTGAGCCTAATTGAGCCCGG + Intergenic
978580881 4:110229960-110229982 GAGCTCAGCCTATTACAGTCAGG + Intergenic
982159681 4:152555110-152555132 GTGATGAAGCTATTTTAGACAGG - Intergenic
982908466 4:161108755-161108777 CAGCTGACCCTATTTTAAACAGG + Intergenic
991945596 5:71895744-71895766 GAGCTGAGCCAATTTGGGAGTGG - Intergenic
998187557 5:139993534-139993556 GATGTGAGACTATTTTAGATTGG - Intronic
998512446 5:142724815-142724837 GAGGTGTGGCCATTTTAGACTGG + Intergenic
999046856 5:148478836-148478858 GAGCTAAGTCTATTTTACTCTGG + Intronic
999761122 5:154701977-154701999 GACCTGAGCCTTTTTGTGACAGG + Intergenic
1006802839 6:36770326-36770348 GTGCTGTGCCTATTTTACAAGGG - Intronic
1008670783 6:53766456-53766478 GAGTTGAGTTTATTTTAGTCTGG + Intergenic
1011851816 6:91638717-91638739 GATCAGAGCCTATTTTAGCCAGG - Intergenic
1015338546 6:132070438-132070460 GGTCAGAGCCTATTTTATACTGG - Intergenic
1018987417 6:168648463-168648485 GAGCTCAGCCTTCTGTAGACCGG + Intronic
1019861311 7:3660546-3660568 GAGCTGAGCCCATTATGGGCAGG - Intronic
1022587973 7:31633933-31633955 GAACTCAGACTATTTTAAACAGG + Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1032171176 7:129585773-129585795 GAGCTTTGACTATTTTAGCCCGG + Intergenic
1032819679 7:135513130-135513152 GAGGGGAGCCTAATTTAGATTGG + Intergenic
1033330176 7:140411093-140411115 GAGGTGGGCCTATTTTATCCTGG - Intronic
1049134389 8:140881805-140881827 GGGCTAAGCCTCTTTGAGACTGG - Intronic
1051235609 9:14995459-14995481 GAGATGAGCCTATTTTTAAAAGG - Intergenic
1051857024 9:21580308-21580330 GAGCTGAGTCTTTTTTAAAAAGG + Intergenic
1056257974 9:84819687-84819709 GGGCTGAGCCTGTTTAAGGCTGG - Intronic
1057763589 9:97896333-97896355 GAGCTGAGCCAATTTGGAACAGG - Intergenic
1059399128 9:114057899-114057921 GAGGTGAGACTATTTAAGAATGG + Intergenic
1060262909 9:122091864-122091886 TCCCTGAGCCCATTTTAGACTGG - Intronic
1193834856 X:86329520-86329542 GAGCTGAACCATGTTTAGACAGG - Intronic
1199022733 X:142901130-142901152 GAACTGAGCCTAATTTAAAGAGG - Intergenic