ID: 1100660064

View in Genome Browser
Species Human (GRCh38)
Location 12:96687066-96687088
Sequence CTGTTGGTCTTGAAGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100660064 Original CRISPR CTGTTGGTCTTGAAGACAGA AGG (reversed) Intronic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
905742326 1:40383049-40383071 CTGTTGGTCTTATAAGCAGAGGG + Intronic
906906960 1:49905416-49905438 ATGTTGGTTGTGAACACAGAAGG - Intronic
907629859 1:56069598-56069620 CTGGTGGGCTTGATGAGAGATGG + Intergenic
907754156 1:57293684-57293706 ATGTTGGTCTTGGACACAGTAGG + Intronic
907945529 1:59133014-59133036 TTGGTGGTCTTGAAGTCACAGGG - Intergenic
909715543 1:78702425-78702447 CTGTTGGACTTGAACACTGCAGG - Intergenic
910926059 1:92399299-92399321 CTTTTGGTCTGCAAGACATAGGG - Exonic
911949582 1:104155095-104155117 CTGTTAGTTTTGAAGACACACGG - Intergenic
912061805 1:105682285-105682307 CTGATTGACTTGAAGACAGAAGG - Intergenic
912271090 1:108209597-108209619 CTGTGGGTTTTGAAGACCGTGGG + Intergenic
912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG + Intergenic
913346008 1:117811901-117811923 CTGTTGGTCTTGGAGTCCCAGGG - Intergenic
914667870 1:149847083-149847105 CTGCTTGCTTTGAAGACAGAGGG - Intronic
915392980 1:155561634-155561656 TTTTTGGTCTAGCAGACAGATGG - Intronic
915409136 1:155687552-155687574 TTTTTGGTCTAGCAGACAGATGG - Intronic
916344105 1:163769119-163769141 CTCATGATCTTGAAGACAGATGG - Intergenic
919214917 1:194540818-194540840 CTGTTAATACTGAAGACAGAAGG - Intergenic
919449089 1:197748613-197748635 TTGTGGGCTTTGAAGACAGAAGG + Intronic
919601840 1:199632830-199632852 CTGCAGGTTTTGAAGACAGTGGG - Intergenic
920086956 1:203424416-203424438 ATGCTGGCCTGGAAGACAGAAGG - Intergenic
920200500 1:204257217-204257239 CTGCTGGTCCTGCAGACAAACGG + Intronic
920670092 1:207997417-207997439 CCCTTTTTCTTGAAGACAGATGG + Intergenic
920776199 1:208939776-208939798 CTGGTGGACTTTAACACAGATGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921579299 1:216876475-216876497 CAATTGGTCTTTAAGACAAATGG - Intronic
922098220 1:222460620-222460642 CTGTAGGGCCAGAAGACAGATGG + Intergenic
923291468 1:232550210-232550232 CTGTTGAGCTTTTAGACAGATGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064910815 10:20399925-20399947 CTGTTAGTCTGGGAAACAGATGG - Intergenic
1065903830 10:30230817-30230839 CTCTTTGTCTTGAAGAAATAGGG - Intergenic
1067951051 10:50738972-50738994 CTGTTGGTCCTGGAAAAAGAGGG + Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1070251663 10:74778759-74778781 CTGTCTGTCTTGCAGACAGAGGG + Intergenic
1070886408 10:79904184-79904206 CTGTTGGTCCTGGAAAAAGAAGG + Intergenic
1071909620 10:90216749-90216771 TTGTTGGTTGTGAAGATAGAAGG + Intergenic
1072044823 10:91644127-91644149 CTGTGGGTTGTGAAGACAGCGGG - Intergenic
1072157396 10:92736404-92736426 CTGTTGATCTAGAACTCAGATGG + Intergenic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073598567 10:104823963-104823985 TTGTTGGCTTTGAAGACTGAAGG + Intronic
1075623387 10:123944383-123944405 CTGTGGGTCTTTAAAACAAAGGG + Intergenic
1076542589 10:131223541-131223563 CTGTTGGTTTTGAAGTTAAAAGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1079419609 11:20273731-20273753 CTTTTGGTTTTAAAAACAGAAGG - Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1081080256 11:38732245-38732267 CTGTGGGTTGTGAAGACAGTGGG + Intergenic
1082830260 11:57611813-57611835 ATGATGGCCTTGAAAACAGAAGG - Exonic
1083860446 11:65417514-65417536 CTGGCGGTCCTGAAGACAGAGGG + Intergenic
1083983171 11:66191189-66191211 CTGATGGCCTTGAAGATGGAGGG - Intronic
1084477356 11:69396504-69396526 CAGTTGGCCTGGAAAACAGAAGG - Intergenic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1085792586 11:79508650-79508672 CTTTTTGTGTTGGAGACAGACGG + Intergenic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1085981527 11:81732365-81732387 CTGTAGTTCTTGCAGACACATGG + Intergenic
1086375605 11:86197108-86197130 ATGTTTGTATTCAAGACAGAAGG - Intergenic
1086410660 11:86541124-86541146 CTGAAGGTTTTGAAGACAGTGGG - Intronic
1087561878 11:99800914-99800936 ATATTAATCTTGAAGACAGAAGG - Intronic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1093719684 12:22425315-22425337 CTTCTGGTTTTGAAGACGGAGGG + Intronic
1093759590 12:22892941-22892963 ATGATACTCTTGAAGACAGAGGG - Intergenic
1093869591 12:24272441-24272463 GTCTTGTTCTTGAACACAGAAGG + Intergenic
1094260029 12:28484348-28484370 CTGTTGTTTTTGCTGACAGATGG - Intronic
1095870513 12:47022162-47022184 GTTTTGCTGTTGAAGACAGAAGG + Intergenic
1096039761 12:48503619-48503641 CTGTAGGTCTTGACATCAGATGG - Intergenic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1097797050 12:63873815-63873837 AGGTTGGTCTTGAAGATAGCAGG - Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1101954782 12:109203663-109203685 CTGGTGGTCCTGAGGACAGGGGG - Intronic
1102987628 12:117291348-117291370 ATGTAGGTGTTCAAGACAGAGGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1104344138 12:127980651-127980673 CTCATGGTCTGTAAGACAGAGGG - Intergenic
1105683730 13:22755525-22755547 GTGTTGGACATAAAGACAGAAGG - Intergenic
1107896957 13:44974883-44974905 GTGTGAGACTTGAAGACAGATGG + Intronic
1108141738 13:47430389-47430411 CTGTTAGTCTTTTAGGCAGATGG + Intergenic
1109147320 13:58795860-58795882 ATGCTGGCTTTGAAGACAGAGGG + Intergenic
1109755757 13:66757191-66757213 AAGTTGCTCTAGAAGACAGAGGG - Intronic
1110442683 13:75542836-75542858 TTGCTGATTTTGAAGACAGATGG + Intronic
1112455984 13:99564392-99564414 CTGTTGGTTTTGAAGAGTAAAGG + Intergenic
1115221640 14:31063996-31064018 CTGGTGGTCATGATGAAAGAAGG + Intronic
1115272286 14:31566822-31566844 TTGCTGGCCTTGAAGACAGAAGG + Intronic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1119266964 14:73268495-73268517 CTGGAGGTCTGGGAGACAGAGGG - Intronic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1119974364 14:79008969-79008991 CTGTTGCTCTTCAAGTTAGATGG + Intronic
1122029230 14:98900492-98900514 CTCTAGGACATGAAGACAGAAGG - Intergenic
1123388369 15:19842492-19842514 ATGTAGGTGGTGAAGACAGAGGG - Intergenic
1123875758 15:24622216-24622238 CTGTTGGACTTGAACACAGCAGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125033822 15:35100326-35100348 CTGTTGATCTTGAACAGAGCAGG + Intergenic
1126522959 15:49617969-49617991 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1127012565 15:54645609-54645631 CTGTGGTTCTTGCAGACATATGG - Intergenic
1127704444 15:61533206-61533228 CTGTTGACCTTCAAGTCAGAAGG + Intergenic
1128314464 15:66651950-66651972 GGGTTGGTTTTGAAGACAGCTGG - Intronic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1133657850 16:7883703-7883725 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1140503334 16:75453701-75453723 ATGTTTGGCTTGAAGACAAATGG + Intronic
1140758280 16:78088577-78088599 TTGCTGGCCTTGAAGACAGAAGG - Intergenic
1142066373 16:88065303-88065325 CTGCTGGCTTTGAAGACGGATGG - Exonic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1147559690 17:41501215-41501237 CTCTGGGTGCTGAAGACAGAGGG + Exonic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1150926455 17:69537454-69537476 GAGTTGGTCTTGAAGACAGCAGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1154055834 18:11013296-11013318 TTGCTGGCTTTGAAGACAGAAGG + Intronic
1154248888 18:12726191-12726213 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1155444925 18:25901067-25901089 CTGCTGGCTTTGAATACAGAGGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155779329 18:29811405-29811427 CTGTTGGACCTGAACAGAGATGG + Intergenic
1156535598 18:37861813-37861835 CTGTTGTATTTGAATACAGATGG - Intergenic
1157250484 18:46091775-46091797 CTGTTGATCTTGAAGAAACTGGG - Exonic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158399089 18:57104653-57104675 CTGTGGGTTGTGAAGACTGAGGG + Intergenic
1160989961 19:1856486-1856508 CTGTTGGTCTTGGTGACAGCTGG - Intronic
1162326047 19:10000289-10000311 ATTTTGGTCTTGGAGAAAGATGG - Intronic
1162522437 19:11189783-11189805 CTGTTTGTCCTGCAGGCAGAAGG + Intronic
1162795828 19:13087168-13087190 CTGTGTGTCCTGAAGCCAGAAGG + Intronic
1164518764 19:28960616-28960638 CTGTGGGTCTTCAAGGCAGCAGG + Intergenic
1166536530 19:43578181-43578203 ATGTAGGTCTTGTAGACAGCAGG - Intronic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167534632 19:50041850-50041872 ATGGAGGTCTGGAAGACAGAAGG - Intronic
1167767415 19:51492687-51492709 CTGCTTGACTTGCAGACAGAGGG + Intronic
926559035 2:14394947-14394969 CTGCTGATGTTGAAGACAGAGGG + Intergenic
927111127 2:19864401-19864423 CTTGGGGTCTTGAAGACAAATGG - Intergenic
927928536 2:27029270-27029292 TTGTTGGCTTTGAAGACAGAAGG + Intergenic
928043283 2:27900276-27900298 CAGTTGGCCTTGAAGAGATAAGG + Intronic
928140164 2:28721604-28721626 CTTTTTGTTTTGAAGACATAGGG - Intergenic
928698145 2:33871600-33871622 CTTTTGGGCTTGAAAACAGCTGG - Intergenic
929003994 2:37378039-37378061 ATGTTTGTCATGAAGACTGAGGG + Intergenic
929837672 2:45421779-45421801 CTTTTGTTCTGGAAGACTGAAGG + Intronic
931076451 2:58719113-58719135 GAGTTGGTCTTGAAGAGAGAAGG + Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
934552125 2:95269003-95269025 CTGCTGATCTTGGAGAGAGAGGG + Intergenic
936042205 2:109158554-109158576 CTGTCTGACTTGCAGACAGAGGG + Intronic
937028621 2:118719777-118719799 TTGTCTGTCTTGAAGGCAGATGG - Intergenic
938109404 2:128553900-128553922 CTGCTGGTGTTGAAAACAAATGG + Intergenic
938935300 2:136122284-136122306 CTGTAGGTGTTGGAGACAGAAGG - Intergenic
939088990 2:137757211-137757233 GTGTTGGACCTGAAGAGAGAAGG + Intergenic
939121883 2:138126962-138126984 AAGTTGGTGTTGAAGGCAGAAGG + Intergenic
939612157 2:144324700-144324722 CTCTTGGTCTTTAAGATACAAGG - Intronic
939635592 2:144578657-144578679 CAGTAGGTCATGAATACAGATGG + Intergenic
941797321 2:169613973-169613995 CTGTTGGACTTGAACAGAAATGG - Intronic
943146165 2:184048120-184048142 CTTTTTGTCTTCAATACAGAAGG + Intergenic
943513101 2:188850916-188850938 CTATTGGACTTGGAGACACAAGG + Intergenic
944025599 2:195162612-195162634 CTCTAGGTATTTAAGACAGAGGG - Intergenic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
948161390 2:235827789-235827811 ATGTAGGCCTTGAAGATAGAGGG + Intronic
948686551 2:239674046-239674068 ATGATGTTCTTGCAGACAGATGG - Intergenic
1168926785 20:1588170-1588192 CTCTGGGTATTGAATACAGAAGG + Intronic
1169415504 20:5412857-5412879 CTGTAGGGCATGGAGACAGAGGG - Intergenic
1169499492 20:6145760-6145782 TTGCTGGCTTTGAAGACAGAAGG + Intergenic
1169587155 20:7097492-7097514 CTGTAGTTCTTGAAGACTCATGG - Intergenic
1169775562 20:9249023-9249045 TTGATGGTTTTGAAGATAGAAGG - Intronic
1170222735 20:13958115-13958137 CTGTTTGACTTAAAGCCAGATGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1174200509 20:48803527-48803549 CTGCTGGTCTTGGTGACAGGTGG - Intronic
1174661089 20:52213826-52213848 CTGTTGGCTTTGAAGATGGAAGG - Intergenic
1174879820 20:54267060-54267082 CTGCTGCGCTTGAAGACACAAGG + Intergenic
1176889192 21:14293835-14293857 ATGATGGTCTTCAAGAGAGACGG + Intergenic
1177447635 21:21218356-21218378 CTGTTGGTGTTCAATACGGAGGG + Intronic
949507622 3:4741970-4741992 CTGTTGGCATTAAAGAAAGAGGG + Intronic
949564997 3:5236206-5236228 CTGTGGATGCTGAAGACAGAAGG + Intergenic
951401030 3:22231641-22231663 CAGTAGGTATGGAAGACAGAAGG - Intronic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
951847551 3:27101117-27101139 CATTTGGTCTCTAAGACAGATGG - Intergenic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954466284 3:50656941-50656963 CTGTTGCTCTGGAAGTCAGGTGG + Intergenic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
956596932 3:70977893-70977915 CTGGTGGTTGTGATGACAGAGGG + Exonic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
960461401 3:117940335-117940357 ATGTGGGTCTTTAAAACAGAAGG - Intergenic
960584486 3:119308478-119308500 TGGTTGGCTTTGAAGACAGATGG - Intronic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
969342723 4:6552438-6552460 CTGATGGTTTTGAAGATGGAGGG - Intronic
970654273 4:18213703-18213725 CTGTTGGACCTGAACAGAGAAGG - Intergenic
971496452 4:27271106-27271128 CTGTAGGAGTTGAAGACACAAGG - Intergenic
972957755 4:44413926-44413948 CTGCTGGCTTTGATGACAGAAGG + Intronic
976152781 4:82108794-82108816 CTGTTGCTCTGGGAGGCAGATGG - Intergenic
976944267 4:90745231-90745253 TTGCTGGTTTTGAAGATAGACGG - Intronic
977494752 4:97760945-97760967 CTGCTGGCTTTGAAGACTGATGG - Intronic
977938814 4:102835879-102835901 CTGTGGGTTAAGAAGACAGAGGG - Intronic
978090235 4:104706830-104706852 CTGTGGATTTTGAAGACAGTGGG - Intergenic
979815663 4:125100625-125100647 TTGATGGCTTTGAAGACAGAAGG + Intergenic
983319359 4:166176149-166176171 CTGCAGGACTTAAAGACAGATGG - Intergenic
983641641 4:169948921-169948943 CTGTGGGTCATGCAGACAGCTGG - Intergenic
985561542 5:589188-589210 ATTTTGGCTTTGAAGACAGAAGG + Intergenic
986231288 5:5866839-5866861 ATGTTGGTTGTGAAAACAGAAGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986549405 5:8935879-8935901 CTGCTTGTCTTGGAGACAGCAGG + Intergenic
991028116 5:62052488-62052510 CTGTTGGACTTGAACAGAGCAGG - Intergenic
991605705 5:68398553-68398575 TTGATGGCCTTAAAGACAGAAGG + Intergenic
992134925 5:73734679-73734701 CTGTTGATCTTCTAAACAGATGG + Intronic
993072147 5:83178567-83178589 CTGTTGGTTTTGAAAACAAAGGG + Intronic
993701051 5:91119859-91119881 CTATTGGATTTGCAGACAGAAGG + Intronic
994189674 5:96855788-96855810 CTGTTGGTCTTGTAGGTAAAAGG + Intronic
994697735 5:103093363-103093385 TTGTTGGCTTTGAAGATAGAGGG + Intronic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
997569703 5:134916988-134917010 TTGTTGTTCCTGTAGACAGAAGG + Intronic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1004196191 6:13507412-13507434 ATGTTGCTCTGGAAGGCAGAAGG + Intergenic
1004459543 6:15822912-15822934 TGGTTGGCTTTGAAGACAGAGGG - Intergenic
1007778781 6:44239083-44239105 CTGGTGGGCATGATGACAGAAGG + Intergenic
1010452568 6:76019226-76019248 CTGTTGGTCTGGAAACCAGCAGG + Intronic
1010574890 6:77518497-77518519 CTGTGGGTTGTGAAGACAGTGGG - Intergenic
1011508354 6:88072697-88072719 TTGTTGCTCTGGAAGAGAGAAGG - Intergenic
1012229025 6:96738352-96738374 CTCTTGGTCTCCAAGACAGCTGG + Intergenic
1012279584 6:97312924-97312946 GTGCTGGATTTGAAGACAGAGGG + Intergenic
1012368167 6:98468678-98468700 CTGTTTCTCATGAAGACTGATGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012432663 6:99182196-99182218 TTTTTTTTCTTGAAGACAGATGG + Intergenic
1013287325 6:108692723-108692745 CTGCCGGCCTTGAAGACGGAGGG + Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014767162 6:125420258-125420280 ATGTAGGCCTTGAAGACAAAAGG + Intergenic
1015006712 6:128291230-128291252 TCGCTGGTCTTGAAGACAGAAGG + Intronic
1015211259 6:130701598-130701620 CTGTTGGTTGTGAAGACTGTGGG - Intergenic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1015982581 6:138853906-138853928 GTCTTGGTCTTGCAGGCAGATGG + Intronic
1017685741 6:156912569-156912591 CTTTTGGGTTTGAAGACAGAGGG - Intronic
1019296458 7:278347-278369 TCGTTGCTTTTGAAGACAGATGG + Intergenic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1024134153 7:46389597-46389619 CCTTTGGACTTGAAGCCAGAGGG + Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1026529263 7:71183293-71183315 GTGTAGCTCTTGAAGACAGAAGG + Intronic
1026613577 7:71882210-71882232 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1028127778 7:87134026-87134048 TTGTTGATTTTGAAGACGGAAGG + Intergenic
1030694976 7:112575100-112575122 TTGTTGACTTTGAAGACAGAAGG - Intergenic
1031478933 7:122255278-122255300 CTGTGGCTGTTGAATACAGAAGG - Intergenic
1034036226 7:147825866-147825888 GTGTGGGTGTTGAAGATAGAAGG + Intronic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034391926 7:150793769-150793791 ATTTTTCTCTTGAAGACAGATGG - Intronic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035397004 7:158541182-158541204 ATGTTTGTCTTGAAGACATAGGG + Intronic
1038961552 8:32525703-32525725 GTGTTGGTGCTGAAAACAGAGGG - Intronic
1042044592 8:64634989-64635011 CTGTTGGACTTGACAACTGAAGG + Intronic
1042114613 8:65416854-65416876 CTGGTGTTCTTCAAGCCAGATGG + Intergenic
1042348225 8:67749569-67749591 CTGATGGTGCTGAAGACAGCTGG - Intergenic
1045681212 8:104662394-104662416 ATCTTGGTCTTGAACAGAGATGG + Intronic
1045868901 8:106902902-106902924 TTGTTGGATTTGAAGACAAAAGG - Intergenic
1046780429 8:118209169-118209191 CCTTTGGTCTGGAACACAGAGGG + Intronic
1047572068 8:126110063-126110085 TTGTTGACCTTGAAGATAGAAGG - Intergenic
1049409919 8:142468353-142468375 CCGTTGGTCTTGTGGAAAGACGG + Intronic
1052142710 9:25006694-25006716 CAGTTGGTTTTGAAGATAGGTGG - Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056235259 9:84587991-84588013 GTGTTGGCATGGAAGACAGAGGG - Intergenic
1056788291 9:89608443-89608465 GTGTTGGTCCTGAAACCAGACGG - Intergenic
1057303742 9:93900868-93900890 TTGCTGGTTTTGAAGACGGAGGG - Intergenic
1057958172 9:99428858-99428880 CTGCTGGCTTTGAAGATAGAAGG + Intergenic
1058196112 9:101978542-101978564 CTGCTGGCTTTGAAGACAGAAGG - Intergenic
1059175940 9:112170281-112170303 CTGTGATTCCTGAAGACAGAGGG + Intronic
1062229375 9:135472934-135472956 CTGGTGGTCATGAAGGGAGATGG - Intergenic
1203376994 Un_KI270442v1:384372-384394 CTGTTGGTTCTGGAGGCAGAAGG + Intergenic
1186792484 X:13012477-13012499 CTGCTGGCTTTGAAGATAGAGGG + Intergenic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1188316739 X:28683807-28683829 CTGCTGGCTTTGAAGACAGAAGG - Intronic
1188501972 X:30837007-30837029 GTGTTGGTCCCAAAGACAGAAGG + Intronic
1188537473 X:31213543-31213565 GTGTGGCTCTTGCAGACAGAGGG + Intronic
1189278082 X:39801769-39801791 ATGAGGGTCTTCAAGACAGAAGG + Intergenic
1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG + Intronic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1190959821 X:55234976-55234998 CTGTGGGTTGTGAAGACAGTGGG + Intronic
1191168588 X:57418384-57418406 CTGTGGGTTTTGAAGACTGTGGG + Intronic
1192023910 X:67427524-67427546 CTGTGGGTTTTGAAGACTGTGGG + Intergenic
1192977713 X:76303575-76303597 CTGTGGGTTGTGAAGACAGTGGG + Intergenic
1193989180 X:88284960-88284982 TTGTTGGTTTTGAAGATGGAAGG + Intergenic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1194576404 X:95619088-95619110 CTGTGGGTCATGAAGACTGTGGG + Intergenic
1195112586 X:101662243-101662265 ATCTTGTTCTTGAAGACAGTGGG + Intergenic
1196486681 X:116218622-116218644 TTGTTGGTCTTGCCAACAGATGG - Intergenic
1197551430 X:127897438-127897460 CTGTTGGTCTTTAACAGAGATGG - Intergenic
1198502364 X:137264144-137264166 CTGTTGGTCTTGAAGATTCATGG - Intergenic
1199169056 X:144714869-144714891 CTGTAGGTCTTGAATACTGTGGG + Intergenic
1200041915 X:153376757-153376779 CTGCTGGCTTTAAAGACAGAGGG + Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic