ID: 1100662617

View in Genome Browser
Species Human (GRCh38)
Location 12:96716662-96716684
Sequence GCCTCCAGGATAGCAGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100662617_1100662620 24 Left 1100662617 12:96716662-96716684 CCAAGTGCTGCTATCCTGGAGGC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1100662620 12:96716709-96716731 GACCTTGCCTAGAAAGCCATAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1100662617_1100662623 28 Left 1100662617 12:96716662-96716684 CCAAGTGCTGCTATCCTGGAGGC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1100662623 12:96716713-96716735 TTGCCTAGAAAGCCATAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1100662617_1100662621 25 Left 1100662617 12:96716662-96716684 CCAAGTGCTGCTATCCTGGAGGC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1100662621 12:96716710-96716732 ACCTTGCCTAGAAAGCCATAGGG 0: 1
1: 0
2: 1
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100662617 Original CRISPR GCCTCCAGGATAGCAGCACT TGG (reversed) Intronic
904402250 1:30264443-30264465 GCCTCTAGGGCAGCAGCACGTGG - Intergenic
907045722 1:51298925-51298947 GCCTCTAGGCTGCCAGCACTGGG + Intronic
907047982 1:51311651-51311673 GCCTCCAGGACAGCTGCATGTGG + Intronic
907864853 1:58389930-58389952 GCCTGCCGGGCAGCAGCACTTGG + Intronic
920618781 1:207523698-207523720 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920620563 1:207542269-207542291 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920622345 1:207560826-207560848 GCTTCCAGGATTGCAGCGGTAGG - Exonic
923262516 1:232281136-232281158 GGCTGCAGGATAGCAGTACCTGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924139104 1:241003710-241003732 GCCTCCAGCAAAGCACTACTGGG + Intronic
924546587 1:245033344-245033366 GCCTCCGGGAGAGGAGAACTCGG - Intronic
924665927 1:246071704-246071726 GCTTTCAGGATTGCAGCATTTGG - Intronic
1063191266 10:3697024-3697046 GTGTCCATGATGGCAGCACTGGG - Intergenic
1066535163 10:36383152-36383174 GCCTCCAGGATATAAACAATTGG + Intergenic
1069269850 10:66513453-66513475 GCCTCCAGGCAAGCAGTCCTTGG + Intronic
1069620812 10:69836294-69836316 TCCTCCAGGATTCCAGCCCTGGG + Intronic
1069668035 10:70177479-70177501 GCTTACAGTCTAGCAGCACTTGG + Intergenic
1071139383 10:82489911-82489933 ATCTCCAGGAAAACAGCACTGGG - Intronic
1072727966 10:97826303-97826325 GCCTCCAGCACAGCAGCTCATGG - Intergenic
1073287869 10:102399351-102399373 GCCTCCCGGGTAGCAGCCCATGG - Exonic
1075078361 10:119366641-119366663 GCCTCCAGGATAGAAAGACATGG - Intronic
1075250847 10:120870932-120870954 GCATTCTGGATAGCAGGACTCGG + Intronic
1076854038 10:133106533-133106555 GTCCCCAGCACAGCAGCACTGGG + Intronic
1077905336 11:6528647-6528669 ACCTCCAAGATACCAGCAATTGG - Exonic
1078786458 11:14499451-14499473 TCCTCCAGCAAAGCAGCCCTAGG + Intronic
1079313583 11:19388646-19388668 GTCTCTAGGAAAGCAGCATTCGG - Intronic
1080517390 11:33037142-33037164 GCCTCCAGGGAAGCTGCCCTTGG - Intergenic
1081932174 11:46879111-46879133 GCCCCCAGGTGAGCAGCCCTTGG - Exonic
1082821482 11:57547231-57547253 GCCTGCAGGTCAGGAGCACTTGG - Intronic
1084364441 11:68688331-68688353 GCCTCCAGAAGAGCGGGACTGGG + Intronic
1086127612 11:83365426-83365448 GCCTCTAGGGTAGCATCACATGG - Intergenic
1089063316 11:115643654-115643676 CCCTCCAGGCCAGCAGCGCTGGG + Intergenic
1089862968 11:121606576-121606598 GGCTGCAGGATAGAATCACTTGG - Intronic
1091254749 11:134173500-134173522 TGCTGGAGGATAGCAGCACTGGG + Intronic
1093372056 12:18377150-18377172 GGCTCCAGGATGCCAGCAATGGG + Intronic
1096153529 12:49329492-49329514 GCCTCCAGGCTGGCAGCACAGGG - Intronic
1096633788 12:52945898-52945920 GCCTCCAGATTCCCAGCACTAGG - Intronic
1097703283 12:62842076-62842098 GGCTCCAACAGAGCAGCACTGGG - Intronic
1098074693 12:66716397-66716419 ACCTCCAGGAGAGAAGCCCTGGG + Intronic
1098114846 12:67164202-67164224 TCCTCCTGGAGAGCAGAACTGGG - Intergenic
1100662617 12:96716662-96716684 GCCTCCAGGATAGCAGCACTTGG - Intronic
1103505054 12:121437100-121437122 GAGTCCAGGATGGCAGCAGTGGG + Intronic
1104584159 12:130034449-130034471 GCCTCCAGGAAAGGGGCACTAGG + Intergenic
1105005283 12:132717583-132717605 GCCTCCATGCTTGCAGCAGTGGG + Intronic
1105294568 13:19076402-19076424 GCCTGCAGGAAGGCAGCTCTGGG - Intergenic
1105820311 13:24075117-24075139 GCCTCTAGCAGAGCAGGACTGGG - Intronic
1108672208 13:52703000-52703022 ACCTCCAGGGAAACAGCACTAGG - Intergenic
1109076079 13:57836743-57836765 GATTCCTGGATACCAGCACTGGG - Intergenic
1114401287 14:22413250-22413272 GCCCCCTGGATTGCAGCATTTGG + Intergenic
1121529329 14:94641418-94641440 GCCCCCAGGACAGCAGCCCTGGG + Intergenic
1122132439 14:99612710-99612732 TCCTCCAGGAGGGCACCACTGGG - Intergenic
1122199370 14:100113193-100113215 GCATCCAAGATGGCAGCACTAGG - Intronic
1123502627 15:20903614-20903636 GGCTCCTGGATGGCACCACTGGG + Intergenic
1123559875 15:21477281-21477303 GGCTCCTGGATGGCACCACTGGG + Intergenic
1123596112 15:21914580-21914602 GGCTCCTGGATGGCACCACTGGG + Intergenic
1124258312 15:28164003-28164025 GCCTCCTGGAGGGCAGCACTGGG + Intronic
1124345129 15:28917190-28917212 ACCCCCAGGAAAGCAGTACTGGG + Intronic
1128179481 15:65589060-65589082 GCTTCCAACATAGCAACACTTGG - Intronic
1128793277 15:70448520-70448542 GCCTCCAGGGTAGCAGGCCAGGG + Intergenic
1129016813 15:72475233-72475255 GCCTCCGCCATAGCAGGACTTGG - Intronic
1129164246 15:73767321-73767343 GACTCCAGGAGGGCAGCACGGGG + Intergenic
1129389745 15:75214604-75214626 GGCTCCAGAAGAGCTGCACTGGG - Intergenic
1132278101 15:100587460-100587482 GCCTCCAGGATAGACTCAGTGGG + Intronic
1202968219 15_KI270727v1_random:204443-204465 GGCTCCTGGATGGCACCACTGGG + Intergenic
1132829592 16:1920796-1920818 GCGCCCAGGATGGCAGCACTGGG + Intergenic
1136126432 16:28185726-28185748 GCTGCCAGGATGGCAGCACAAGG + Intronic
1138008419 16:53357611-53357633 GCCTCTGGGGTAGCAGCCCTGGG + Intergenic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1143651190 17:8265135-8265157 GGCTCCAGGATAGAAGCTGTGGG - Intronic
1144845857 17:18218655-18218677 GCCTCCAGAGAAGGAGCACTCGG + Intergenic
1145869317 17:28260419-28260441 GCCTCAAGGAAAACAGCTCTGGG + Intergenic
1148495938 17:48053677-48053699 GGCTCCAGGGGAGCAGCAGTGGG + Intronic
1148890136 17:50801238-50801260 GCCCCCATTATAACAGCACTCGG + Intergenic
1152374552 17:79912476-79912498 GCCTCCAGGATGTCTGTACTGGG - Intergenic
1152579344 17:81159239-81159261 GCGTCCACGATAGCAGCCCACGG + Intronic
1153144855 18:2019789-2019811 GCCTCCAGTATAACAACAGTGGG - Intergenic
1153753290 18:8255764-8255786 CCCTCCAGGAGGGCAGCACAAGG - Intronic
1154333016 18:13445099-13445121 CCCTCCAGGGCTGCAGCACTGGG - Intronic
1156272881 18:35553167-35553189 GCCTCGAAGATAACAGCAGTGGG + Intergenic
1159432855 18:68378047-68378069 GCCTCCAGGGTTGCTGTACTAGG - Intergenic
1160906320 19:1453288-1453310 GCCCCGAGGACACCAGCACTCGG - Exonic
1162896185 19:13765863-13765885 GGCTCCAGGACAGCAGCGTTAGG + Intronic
1163580861 19:18137716-18137738 GCCTCCAAAAAAGCTGCACTAGG - Intronic
1168723580 19:58568966-58568988 CCATCCAGGATACCAGGACTGGG + Intronic
925853855 2:8110431-8110453 GTCTTTAGGATAGCAGCACCAGG - Intergenic
927897900 2:26796652-26796674 GCTTCCAGCAGAGCAGCAGTGGG - Intronic
928026828 2:27746909-27746931 GCCTCCAGGTTTCCAGCTCTCGG + Intergenic
929965322 2:46530238-46530260 GGCGCCAGGAGAGAAGCACTGGG + Intronic
929973064 2:46600971-46600993 GCTTCCATGATAGCATTACTAGG + Intronic
929994439 2:46816602-46816624 GGCCCCAGGACAGCAGCACGAGG - Intergenic
933719801 2:85390674-85390696 GCCTCAAGCCTAGCAGCTCTAGG - Exonic
934765875 2:96879753-96879775 GCCTCCAGGAGAGCTGCCCTGGG + Intronic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
937475662 2:122212962-122212984 GCCTTGAAGATAGCACCACTTGG + Intergenic
937647955 2:124286644-124286666 GCCAACAGAATAGCATCACTGGG - Intronic
938249104 2:129799779-129799801 GCCGCAAGGCTAGCAGCACGTGG + Intergenic
938893149 2:135725693-135725715 GACTCCAGGAAAGCTGCAGTTGG - Intergenic
939672574 2:145031477-145031499 TCTTCCAGGATTGCAGCACCAGG - Intergenic
946023732 2:216659424-216659446 ACCTGCAGGAGAGCAGCTCTGGG + Intronic
948632141 2:239309172-239309194 GCCGCCGGGAGAGCAGGACTTGG - Intronic
1169258534 20:4118310-4118332 GGCTCCTGGAGAGCAGCAATGGG - Intergenic
1169411351 20:5373019-5373041 GCCTACAGAGGAGCAGCACTAGG - Intergenic
1171078002 20:22148872-22148894 GCGTGAAAGATAGCAGCACTGGG + Intergenic
1172035072 20:32004791-32004813 GTCTCCAGAATAGTAGCACCAGG + Intergenic
1172219261 20:33261600-33261622 GCCACCAGAATATCCGCACTGGG + Intergenic
1173710391 20:45150645-45150667 GTGTCCAGGATTGCAGCAGTAGG + Intergenic
1174182887 20:48686220-48686242 TCCTCCAGGGTAGAAGGACTTGG - Intronic
1178579758 21:33828449-33828471 GCCACCAGGATAGAAGCACCTGG - Intronic
1178929129 21:36802230-36802252 GCCTCCAAGATTGCAGCATAAGG + Intronic
1180183098 21:46126686-46126708 GGCCCCAGGATGGCAGCACAGGG + Intronic
1180964557 22:19779913-19779935 GCTTACTGGACAGCAGCACTTGG - Intronic
1181026203 22:20129214-20129236 GCTTCCAGGAGAGAAGCCCTTGG + Intergenic
1182073926 22:27482017-27482039 GCCTCCATGAAACCAGCACTTGG + Intergenic
1182356585 22:29724920-29724942 GGCTCCAGCAAAGCAGCCCTGGG + Intronic
1182876969 22:33700659-33700681 GCCTCCAGGCCACCAGCATTTGG - Intronic
1185141853 22:49106952-49106974 GGTTCCAGGATGGCAGCCCTGGG + Intergenic
949907865 3:8873564-8873586 GCGGACAGGAAAGCAGCACTTGG - Intronic
950849710 3:16051121-16051143 GCCTTCAGGCCACCAGCACTTGG + Intergenic
963041317 3:141072037-141072059 GCCTCCAGGACATCTGGACTTGG + Intronic
974842919 4:67318809-67318831 CCCTCCAGCTTAGCAGAACTGGG + Intergenic
974916759 4:68187345-68187367 GTCTCCAAGACACCAGCACTTGG + Intergenic
979344270 4:119568054-119568076 TCCTCTAGGATAGCAGAACAAGG + Intronic
986301932 5:6484273-6484295 TCCTCCAGGAAACCAGGACTTGG - Intronic
987276500 5:16368707-16368729 GGCTGCAGGATGGAAGCACTTGG - Intergenic
990494090 5:56329419-56329441 GCCCCATGGATAGCAGCCCTCGG - Intergenic
995806785 5:116061693-116061715 GCTTCCATGATAGCAGTATTAGG - Intergenic
996169405 5:120270063-120270085 GCTTCCAGGATTTCAGCATTTGG + Intergenic
996789546 5:127277964-127277986 GCCTCCTGGACATCACCACTTGG - Intergenic
1002976239 6:2080688-2080710 GGCCCCATGATAGCAGCAGTGGG + Intronic
1003925220 6:10871225-10871247 GCTTCCAGGATCTCAGCATTTGG + Intronic
1006414131 6:33893299-33893321 GCCTCCAGGAAAGCATCTCCCGG - Intergenic
1007431096 6:41777740-41777762 CCCTCCAGGATTCCAGTACTTGG + Intronic
1009305202 6:62080975-62080997 GCTTCCAGGATAGTAACAGTGGG - Intronic
1014803876 6:125807651-125807673 ACATCCTGGATAGCAGCATTAGG - Intronic
1015541433 6:134317860-134317882 GCCTCCAGGAGCGCATCACCTGG - Exonic
1019600271 7:1879663-1879685 GTATTCAGGATAGCAGCACAAGG + Intronic
1020028431 7:4916170-4916192 GCCTACAGGTTAGCAGGGCTGGG + Intronic
1023893985 7:44416912-44416934 GCCTGCATGATAGGAGGACTGGG + Intronic
1026127676 7:67593910-67593932 ACCTACAGGGCAGCAGCACTAGG - Intergenic
1027473065 7:78596410-78596432 TCCTTCAGGATAGAAGCTCTTGG - Intronic
1028960830 7:96748576-96748598 GCCTCCAAGTTAGCAGCCTTAGG + Intergenic
1030306639 7:108025896-108025918 CCTTCCTGGATAACAGCACTTGG + Intronic
1033804187 7:144936213-144936235 GCTTTCATTATAGCAGCACTTGG + Intergenic
1035699461 8:1626979-1627001 CCCTCCTGGTCAGCAGCACTTGG + Intronic
1037682672 8:21110511-21110533 GCCTCCAGCTTGGCTGCACTTGG - Intergenic
1037897811 8:22669840-22669862 CCCTCCAGGAAAGTAGCTCTGGG - Intergenic
1044597535 8:93972921-93972943 GGCCCCAGGATCGCAGCTCTTGG - Intergenic
1047219707 8:122909739-122909761 GCCCACAGGACAGCAGCAGTGGG - Intronic
1049083283 8:140458462-140458484 GCCTCCAGGATCGCAGGGCCCGG + Exonic
1049330068 8:142045719-142045741 CCCTCCAGGGTAGAAGCACGAGG + Intergenic
1057265267 9:93613299-93613321 GCCTGCAGGAAGGCAGCTCTGGG + Intronic
1059385797 9:113963217-113963239 GCCTCCAGGTTAAATGCACTTGG + Intronic
1061125969 9:128675910-128675932 GCCTCCAGGGTAGCTGGACCTGG - Intergenic
1186013419 X:5163893-5163915 ACCTCCCAGATAGCAGCCCTTGG - Intergenic
1189647810 X:43153354-43153376 GCCAGCAGGGTAGCAGCAATTGG - Intergenic
1196463842 X:115953293-115953315 AACTCCAGGATAGCGGGACTGGG + Intergenic
1199239205 X:145526767-145526789 GACTACTGGATAGCAGCTCTGGG + Intergenic
1201410035 Y:13690492-13690514 TGCTCCAGGATACCAGCTCTGGG + Intergenic