ID: 1100665278

View in Genome Browser
Species Human (GRCh38)
Location 12:96745259-96745281
Sequence CAACCACTGTGGAGACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 7, 2: 46, 3: 104, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100665278 Original CRISPR CAACCACTGTGGAGACAGTG TGG (reversed) Intronic
900962393 1:5933499-5933521 CATCCACAGTGCAGACAGTAGGG + Intronic
901043962 1:6384426-6384448 CAGCCACTTTGGAAACAGTCTGG + Intronic
903456151 1:23488333-23488355 CAATCACAGTGGGGACAGAGAGG - Intergenic
904323919 1:29714911-29714933 CAGCCCCTGTGGAAACAGTATGG - Intergenic
904692462 1:32303974-32303996 TAACCTCTCTGGAGACAGTGAGG + Intronic
904716055 1:32468414-32468436 CAATCACTGTGGTCACAGGGTGG + Intronic
905284016 1:36867772-36867794 CAAGCCCTGTGCAGACAGAGTGG - Intronic
905321184 1:37118600-37118622 GAGCCAGGGTGGAGACAGTGTGG + Intergenic
906002254 1:42436883-42436905 CAGCCTCTGTGGAAACAGTTTGG + Intronic
907501091 1:54881557-54881579 CAACCATGTGGGAGACAGTGTGG + Intronic
907532547 1:55115586-55115608 CAATCATTGTGGAGACAGTGTGG + Intronic
907960404 1:59274796-59274818 AAAAGACTGTGGATACAGTGTGG - Intergenic
907996857 1:59641824-59641846 GATCCACTGTGGAAACAGTTTGG + Intronic
908482343 1:64554458-64554480 CAGCCACTGTGGAAGCAGTCTGG - Intronic
909353033 1:74675855-74675877 CCAGCACTCTGCAGACAGTGAGG + Intergenic
910986186 1:93007263-93007285 TAAACACTGTGAATACAGTGCGG + Intergenic
911222323 1:95262178-95262200 CAACCACTTTGGAAACAATTTGG - Intergenic
911402873 1:97398518-97398540 CAACCATTGTGAAGTCAGTGTGG - Intronic
911790421 1:102008695-102008717 CAGCCACTGTAGAAACGGTGTGG + Intergenic
912007871 1:104926969-104926991 CAACCTTTGTGGAAAGAGTGTGG - Intergenic
912508591 1:110173323-110173345 CATCCACTCTGGACACAGGGTGG - Intronic
914865629 1:151425926-151425948 CAGCCACTTTGGAAACAGTATGG - Intronic
915551864 1:156640043-156640065 CAAGCCCTGTAGAGCCAGTGTGG + Intergenic
915675813 1:157529365-157529387 CAACCACTATGAAAACAGTATGG + Intronic
915698679 1:157770050-157770072 CAACCTCTGTGGAGAGAGCCGGG + Exonic
915718465 1:157965993-157966015 TAACCTTTGGGGAGACAGTGAGG - Intergenic
915754891 1:158250051-158250073 CAACCTCTGTGCAGACACTGTGG + Intergenic
916460197 1:165015944-165015966 CAACAATTGTGAAGTCAGTGTGG - Intergenic
916625059 1:166546695-166546717 CAACCATTGTGGAGACAGTGTGG - Intergenic
916637257 1:166685890-166685912 CAACCATTGTGGAAGAAGTGTGG - Intergenic
918450125 1:184649868-184649890 CAAGGTCTGTGGAGACAATGAGG - Intergenic
919086265 1:192924373-192924395 CAACCTCTGTGAAAACAGTATGG + Intergenic
919110385 1:193211597-193211619 CAAGCACTGTGATAACAGTGAGG + Intronic
919269482 1:195320768-195320790 CAACTACTATGGAGAAAGTTTGG - Intergenic
919288899 1:195602731-195602753 CAATCACTATGGAAACAGTTTGG - Intergenic
919973227 1:202594141-202594163 ACACCAGTGTGGAGCCAGTGTGG - Exonic
920798811 1:209167780-209167802 CAACCACTTTGGAAACAGTTTGG + Intergenic
922366150 1:224865635-224865657 CAACCACTTTGGAAACAGTTTGG - Intergenic
922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG + Intergenic
922995085 1:229950725-229950747 CAACCTCTATGGAAACAGTGTGG - Intergenic
924250717 1:242130522-242130544 CAACCTCTATGGAAACAGTGTGG - Intronic
924283795 1:242464577-242464599 CAGCCACTGTGGAAACAGTTTGG + Intronic
924690765 1:246347848-246347870 CAGCCACTGTGGAGACAGTTTGG + Intronic
924800810 1:247328842-247328864 CAAGCACTGTGAAGACCCTGTGG - Exonic
924874007 1:248080846-248080868 CAACCAGTGTGAAGACAGTGTGG - Intronic
924934947 1:248759800-248759822 CAGCCACTGTGGAAAGAGTTTGG + Intergenic
1062906917 10:1185574-1185596 CAAACACTCTGTAGCCAGTGCGG - Intronic
1063595967 10:7435955-7435977 CTCCCACTGAGGAGACAGGGTGG + Intergenic
1063604569 10:7510941-7510963 CAGCCACTTTGGAGACAGTTTGG - Intergenic
1066707089 10:38192381-38192403 CAACCTTTGTGGAGACAGTGTGG + Intergenic
1066709843 10:38221818-38221840 CAACCATTGTGAAGACAGTGTGG + Intergenic
1066982603 10:42432295-42432317 CAACCATTGTGGAGACAGTGTGG - Intergenic
1067024787 10:42835425-42835447 CAGCAACTGTGGATACAGTGTGG - Intergenic
1068195514 10:53710796-53710818 CAACCACTTTGGAAACTGTTGGG + Intergenic
1068647180 10:59480750-59480772 TCACCACTGTGGGAACAGTGTGG + Intergenic
1069706115 10:70459892-70459914 CAACTGCTGTGGAGAAGGTGCGG - Intergenic
1069905678 10:71730812-71730834 CAACCACTGGGTGGACAGAGGGG + Intronic
1070580089 10:77712427-77712449 CAAGAACTGTGGAGACAGCAAGG + Intergenic
1071141404 10:82513519-82513541 CAACCATTGGAAAGACAGTGTGG - Intronic
1072177388 10:92941502-92941524 CAGCCACTATGGAAACAGTATGG - Intronic
1072496193 10:95962465-95962487 CAGCCACTTTGGAAACAGTTTGG + Intronic
1072653408 10:97313129-97313151 AAACCACTGGTTAGACAGTGGGG - Intergenic
1073556694 10:104460022-104460044 CAACGATTGTGTAGACAGTGTGG - Intergenic
1073733442 10:106318824-106318846 CAACCATGGTGAAGATAGTGTGG + Intergenic
1074453189 10:113575910-113575932 CAACCCCTGTGAACACGGTGGGG + Exonic
1074758316 10:116644613-116644635 CAGCCACTTTGGAAACAGTTTGG - Intronic
1075126100 10:119700406-119700428 CAAGAACTGTGGGGACTGTGGGG + Intergenic
1075301431 10:121328140-121328162 CAGCCACTATGGAGACAGTTTGG - Intergenic
1075532170 10:123238832-123238854 CAAGCACTGTGCAGAGACTGGGG - Intergenic
1075638547 10:124047954-124047976 CTGCCTCTATGGAGACAGTGAGG - Intronic
1076077151 10:127543102-127543124 CTACCACAGTGAAAACAGTGTGG - Intergenic
1076930923 10:133531352-133531374 AAACCACAGTGCAGACTGTGAGG + Intronic
1078414793 11:11156368-11156390 CATCCAATGTCGAGTCAGTGCGG + Intergenic
1078606522 11:12781737-12781759 TAACCACTCTGGAAACAGTCTGG + Intronic
1079153691 11:17924578-17924600 GAAGCACTGTGGTGGCAGTGTGG + Intronic
1079234159 11:18675746-18675768 CAACCAATGTGGAGAATGGGAGG - Intergenic
1079466236 11:20733626-20733648 CTACCACTGTGCAGTCATTGAGG + Intronic
1079495708 11:21041515-21041537 CAACCACTCTGGAGAAAATGTGG + Intronic
1080214487 11:29825775-29825797 CACCTACTTTGGAGAAAGTGAGG + Intergenic
1080398290 11:31910395-31910417 CAACCATTGTGGAACCAGTGTGG + Intronic
1080964343 11:37196562-37196584 CACCCTTTGTGGAGGCAGTGAGG - Intergenic
1081323892 11:41722315-41722337 CAACCATTGTAGAGACAGTGTGG - Intergenic
1082151463 11:48745206-48745228 CAACCATTGTGAAGTCAGTGTGG - Intergenic
1082712236 11:56567086-56567108 CATCCACTGTGGAAGCAGTTTGG - Intergenic
1082896371 11:58194744-58194766 CAACCACTTTGAAAACAGTTTGG - Intergenic
1084536378 11:69759734-69759756 ACGCCACTGTGGACACAGTGAGG - Intergenic
1085672795 11:78484802-78484824 CAACCACTGCGAAGACAGTGTGG + Intronic
1086260091 11:84929260-84929282 CAACCACTGTATAGGCACTGGGG - Intronic
1086328752 11:85732161-85732183 CAACTGTTGTGAAGACAGTGTGG + Intronic
1086497017 11:87414849-87414871 CAACCATTTGGAAGACAGTGTGG + Intergenic
1086736215 11:90308319-90308341 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1087083050 11:94190229-94190251 CAACCACTGTGGAGACAATGTGG - Intergenic
1087525166 11:99299968-99299990 CAACTTCTATGGAGACAGTATGG - Intronic
1088378094 11:109163467-109163489 CACACACTGTGGAGACGGTTGGG + Intergenic
1089008328 11:115112142-115112164 AAACCACAGTGGAGGGAGTGGGG - Intergenic
1089179843 11:116575691-116575713 CAACCATTGTGGAGTCAGTGTGG + Intergenic
1090466100 11:126935284-126935306 CAGCCACTTGGAAGACAGTGTGG + Intronic
1090940700 11:131385526-131385548 CAACCACAGTGGAAAGAGTTTGG + Intronic
1091047237 11:132335440-132335462 CAACCTCTTTGGTGCCAGTGTGG + Exonic
1091989723 12:4945580-4945602 CAGCCACTTTGGAGTCAGTTTGG - Intergenic
1092134149 12:6134253-6134275 AAAGCACTTTGGAGAAAGTGTGG + Intergenic
1092516946 12:9224728-9224750 CAACCATTGTGAAGACAGTGTGG - Intergenic
1093171692 12:15868383-15868405 CAACCACTCTGGAAAAAGTTTGG + Intronic
1093363019 12:18255536-18255558 CAACCAGTTGGGAGATAGTGAGG - Intronic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1095538083 12:43276101-43276123 CAACCATTGTGAAGACAGTGCGG + Intergenic
1097228187 12:57491605-57491627 CAGTCACTCTGGAGGCAGTGTGG - Intronic
1098528889 12:71518418-71518440 CAACCATTGTGAAGACAGTGTGG + Intronic
1099059316 12:77886348-77886370 CATACATTGTGGTGACAGTGGGG - Intronic
1099528309 12:83742740-83742762 CAACCATTGTGGAGACAGTGTGG + Intergenic
1100119598 12:91353527-91353549 CTAGCCCTGTGGAGACAATGTGG - Intergenic
1100665278 12:96745259-96745281 CAACCACTGTGGAGACAGTGTGG - Intronic
1101106854 12:101448983-101449005 CAACCTCTATGGAAACAGTATGG - Intergenic
1102251846 12:111392917-111392939 CAGGCACTGGGGATACAGTGGGG - Intergenic
1103596831 12:122029357-122029379 CAACCCCCGTGGTGACAGGGTGG + Intronic
1103965365 12:124635759-124635781 CAACCACTTTGGAAACAGTTAGG - Intergenic
1104498667 12:129264486-129264508 CAGCCACTAAGGAAACAGTGTGG + Intronic
1104746291 12:131212873-131212895 CAACCAATGTAGAAACAGTTTGG + Intergenic
1105430269 13:20330818-20330840 CAACCATTGTGGAAACATTATGG + Intergenic
1105446169 13:20459265-20459287 CAACCACTGTGAAAGCAGTCTGG + Intronic
1105784319 13:23733530-23733552 CACTCCATGTGGAGACAGTGAGG + Intronic
1106537172 13:30656740-30656762 CAACTGCTGTGGAAACAGTCTGG - Intronic
1108099778 13:46942639-46942661 AAACCATTGTGGATATAGTGTGG + Intergenic
1109226660 13:59704375-59704397 CAAGAGCTGTGGAAACAGTGAGG - Intronic
1109255647 13:60077834-60077856 GATCCACTGTGGAGATAATGGGG - Intronic
1110390227 13:74965008-74965030 CAACCATTGTGAAGACAGTGTGG + Intergenic
1111303261 13:86372544-86372566 CAACCATTGTGGAAACAGTGGGG - Intergenic
1111328956 13:86737334-86737356 CAACCACTATGGAAACAGCATGG + Intergenic
1112152435 13:96778738-96778760 CAACCATTGTGGAAGAAGTGTGG + Intronic
1112806503 13:103168783-103168805 CAGCCACTGTGGAAGCAGTTTGG - Intergenic
1113676651 13:112211988-112212010 CAACCACTGTGGAGTGAATGAGG - Intergenic
1114586677 14:23820982-23821004 CAACCATTGTGGAAACAGTGTGG - Intergenic
1114911817 14:27209216-27209238 CAAACACTATTTAGACAGTGTGG - Intergenic
1114960330 14:27879450-27879472 CAACCATTGTGGAGACAGTGTGG - Intergenic
1115521600 14:34238368-34238390 CCACCATTGTGAAGACTGTGGGG + Intronic
1117262248 14:54047810-54047832 AAACCACTTTGGAGACAGTTAGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119715345 14:76855078-76855100 AAAGCAGTGAGGAGACAGTGAGG + Intronic
1119770025 14:77214665-77214687 AAAAAACTGGGGAGACAGTGAGG - Intronic
1120450516 14:84660782-84660804 CAACTGCTATGGAAACAGTGTGG - Intergenic
1120879020 14:89400381-89400403 CAAGCTCTGTGGAGACATTCGGG - Intronic
1121155281 14:91677626-91677648 CAGCCATTGTGGAGACAGTGTGG + Intronic
1121988016 14:98527537-98527559 CAACCAGTGTGGGTACAGAGAGG - Intergenic
1122259499 14:100504798-100504820 CAACCACTTTGGAAACAGTTTGG - Intronic
1122867331 14:104613100-104613122 CAACCATTGGGAAGACAGTGTGG - Intergenic
1122965547 14:105123182-105123204 CAACTGCTTTGGAGACAGTTTGG + Intergenic
1124043063 15:26122703-26122725 CAGCCACTGTGGAAACAGCATGG - Intergenic
1124553556 15:30705977-30705999 CAAGCAGTGTGGACACACTGAGG + Intronic
1124677688 15:31699691-31699713 CAAGCAGTGTGGACACACTGAGG - Intronic
1125095398 15:35844438-35844460 CAACAACTGTATAAACAGTGGGG + Intergenic
1125145378 15:36461353-36461375 CAACCTCTATGGAAACAGTGTGG - Intergenic
1125887359 15:43238699-43238721 GAACAGCTGAGGAGACAGTGGGG + Intronic
1126017174 15:44363612-44363634 CAACCATTGTGGAAGCAGTGTGG + Intronic
1126670297 15:51110150-51110172 CAAGTACTGGGGAGACAATGAGG + Intergenic
1126919101 15:53500599-53500621 CAACCACTGTGGAAACAGTGTGG - Intergenic
1127074861 15:55315822-55315844 CAACCATTGTGAAGACAGTGTGG + Intronic
1127114336 15:55709439-55709461 CAACTACTTTGGAAACAGTTTGG + Intronic
1127398562 15:58563182-58563204 AAGCCGCTGTGGAGACAGTGGGG - Intronic
1128691484 15:69727674-69727696 AAACCACTGAGGAGGCAGGGTGG - Intergenic
1128747644 15:70125640-70125662 CAGGCACTGGGGAGACAGTGGGG - Intergenic
1129680381 15:77655514-77655536 CATCCACTGGGGACACAGGGAGG - Intronic
1129693826 15:77729327-77729349 CAGCCAATGAGGAGACACTGAGG + Intronic
1130061430 15:80572871-80572893 CAACCACTGTGAAGATCGTCTGG - Intronic
1130665654 15:85867549-85867571 CAGCCACTATGGAGGAAGTGTGG - Intergenic
1131389965 15:92039634-92039656 CAACCACATGGAAGACAGTGTGG + Intronic
1133073503 16:3262616-3262638 GAACCACTGTGGAGGCAGAAGGG + Intergenic
1133858239 16:9569844-9569866 CAACCACTATGGAGGCAGAATGG + Intergenic
1134219222 16:12340446-12340468 CAAGCACTGTCTAGACACTGGGG - Intronic
1134225156 16:12384293-12384315 CAACCACTGTGGAGAAAATTTGG - Intronic
1135471857 16:22738174-22738196 CAAAAACTGTGGATACAGAGAGG + Intergenic
1136230879 16:28884558-28884580 CCCCCACTGTGGAGAGAGTAGGG - Exonic
1136612314 16:31373577-31373599 CCACTAATGTGGAGACAGAGGGG + Intronic
1136672031 16:31867027-31867049 CAACCTCTGAGGAGGCAGAGAGG - Intergenic
1136858823 16:33682650-33682672 CAGCAGCTGTGGATACAGTGTGG + Intergenic
1138276654 16:55740079-55740101 AAACAACTGTGGACACAGAGAGG + Intergenic
1138746810 16:59372652-59372674 CAGCCACTCTGGAAACAGTTTGG - Intergenic
1138804291 16:60076017-60076039 CACCCATTGTGAAGACAGTGTGG - Intergenic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1139897933 16:70303259-70303281 CAGCTACTCTGGAGACAGGGTGG - Intronic
1141544320 16:84754156-84754178 CAGCTACTGTGGAGACAGTGTGG + Intronic
1141747860 16:85938159-85938181 CAATCACTGTCGAGAGGGTGAGG - Intergenic
1203120398 16_KI270728v1_random:1531144-1531166 CAGCAGCTGTGGATACAGTGTGG + Intergenic
1142910348 17:3084124-3084146 CAACCACTATGAAAACAGTGTGG - Intergenic
1143575227 17:7788380-7788402 CAACGACCATGGAGGCAGTGAGG + Intronic
1143930354 17:10416526-10416548 CAGCCACTGTGGAAACAGTATGG - Intronic
1144669411 17:17124559-17124581 GAACCACTGTGGAGGCAGAGGGG - Intronic
1145145617 17:20477040-20477062 AGACCACTGTGGCTACAGTGTGG - Intergenic
1148402660 17:47380652-47380674 CAACCATTGTGGAAGAAGTGTGG - Intronic
1148698046 17:49572935-49572957 CAAGCAGAGTGGACACAGTGCGG - Intergenic
1151266610 17:72961308-72961330 CAACCATCGTGGAGAAAGTGTGG + Intronic
1151695187 17:75711801-75711823 CAACTGCTGTGGAAACAGTATGG + Intergenic
1152717172 17:81905730-81905752 CACGTACTGTGGGGACAGTGGGG + Exonic
1152755981 17:82087248-82087270 CAGCCACTGTGGGGACAGGCTGG + Exonic
1152911381 17:83006906-83006928 CAACCACTCTGGAGACTGTTTGG - Intronic
1155241746 18:23870404-23870426 CATCCACTGTGGAAACACTGTGG + Intronic
1155825257 18:30434452-30434474 CCACCACTTTGCAGATAGTGAGG + Intergenic
1157016766 18:43724579-43724601 CAACCATTATGAAGACAGTGTGG + Intergenic
1157271686 18:46281135-46281157 CGACCACAGCGGAGACAGTGTGG + Intergenic
1157674751 18:49560943-49560965 CAACCACTGCGGACGCAGGGCGG - Intronic
1157690344 18:49676939-49676961 CAACCCCTGGGGTGAGAGTGAGG - Intergenic
1158742260 18:60156433-60156455 CAGCCACTATGGAAACAGTGTGG + Intergenic
1159564750 18:70036113-70036135 CAACCATTGGGAAGGCAGTGTGG + Intronic
1159723306 18:71920650-71920672 CAATCACTGTGGCAGCAGTGGGG - Intergenic
1160195055 18:76746731-76746753 CAACCACTATGGAAACAGTGTGG + Intergenic
1160833503 19:1113934-1113956 CTACCCCTGTGGAGGCAGTGAGG - Intronic
1161359986 19:3842986-3843008 CAGCCATTGTGGAAACAGTCTGG + Intronic
1161958299 19:7508189-7508211 CTTGCACTGTGGAGACAGGGTGG - Exonic
1163980934 19:20899430-20899452 TAACCACTGTGGTGACTGTGTGG - Intergenic
1164217539 19:23162979-23163001 CAACCACTGTGGGGGTAGGGTGG + Intergenic
1164418286 19:28064255-28064277 AAGTCACTGTGGAGACCGTGGGG - Intergenic
1164956929 19:32394386-32394408 CAATCACTGTGGAAACAGTATGG + Intergenic
1165523994 19:36337120-36337142 AAGCCATTTTGGAGACAGTGAGG - Exonic
1165600241 19:37049288-37049310 CAACCATTGTGAAGTCAGTGTGG - Intronic
1165895002 19:39136227-39136249 GGACAACTGTGGGGACAGTGGGG - Intronic
1167577630 19:50325440-50325462 CAACCCCTGTGGAGGAAGGGGGG - Intronic
1167977843 19:53245686-53245708 CAGCCACTATGGAAACAGTACGG + Intronic
925095474 2:1195299-1195321 CAACCATTGTGAAGACAGTGTGG - Intronic
926867810 2:17378817-17378839 CAACCACTATGGAGAATGTTTGG - Intergenic
927689461 2:25197554-25197576 CAACAGCTGGGGAGACAGTGAGG + Intergenic
928622785 2:33108091-33108113 CAACCACGAAGGAGAAAGTGAGG + Intronic
929250571 2:39750171-39750193 CAACCGTTGGGAAGACAGTGTGG - Intronic
929463100 2:42119547-42119569 CAACCACTTTGGAAACATTTTGG - Intergenic
929722457 2:44384047-44384069 CAACCACTATGGAAACAGTGTGG - Intronic
930143077 2:47973297-47973319 CAGCCACTATGGAAACAGTGTGG + Intergenic
930496584 2:52152706-52152728 CATCCACTCTGAAAACAGTGTGG + Intergenic
930548890 2:52806113-52806135 CAAGCACTGTGAAGTCAGTAAGG - Intergenic
930583752 2:53245642-53245664 CAGCCACTGTAGAGGCAGTTTGG + Intergenic
930624393 2:53680316-53680338 CAACCGTTGGGAAGACAGTGTGG - Intronic
931015999 2:57981576-57981598 CAACCTCTGTGGTGAGACTGAGG + Intronic
932518037 2:72373831-72373853 TAACCACTATGGAGACGGTGTGG + Intronic
932713481 2:74084821-74084843 CAGCTACTCTGGAGACAGTGGGG + Intronic
933454788 2:82507566-82507588 CATGCTCTGTGGAGCCAGTGGGG + Intergenic
934054172 2:88238135-88238157 AAACTAATGTGGAGACACTGTGG - Intergenic
935426056 2:102919339-102919361 CAGCCACTTTGGAGACATAGTGG - Intergenic
936821088 2:116521983-116522005 CAACTATTGTGGAAGCAGTGTGG - Intergenic
936858287 2:116986263-116986285 CAACCACTATGCAAACAGTTTGG + Intergenic
938162651 2:128999991-129000013 CAGCCACTATGAAAACAGTGTGG + Intergenic
938856770 2:135321201-135321223 CAACCACTTTGGAAACATTATGG - Intronic
938947819 2:136229452-136229474 CAACCACTATGCAAACAGTGTGG + Intergenic
940449897 2:153824293-153824315 CAACCACTGTGGAAGCAGTTTGG + Intergenic
941036761 2:160577368-160577390 CAACCATTGTGGAACCATTGTGG + Intergenic
941069944 2:160944590-160944612 GGTCCAGTGTGGAGACAGTGAGG - Intergenic
941364648 2:164595392-164595414 CAAACACAATGGACACAGTGAGG + Intronic
941501985 2:166290489-166290511 CAACAATTTTGAAGACAGTGAGG - Intronic
943872777 2:193023112-193023134 CAACCACACTGGAGGGAGTGGGG - Intergenic
943887859 2:193245734-193245756 CAACCATTGTGGAAGAAGTGTGG - Intergenic
944421330 2:199533888-199533910 CAACCATTGTGAAGTCAGTGTGG - Intergenic
945202360 2:207295389-207295411 CAAGGATTGTGGAGACAGTGTGG - Intergenic
945400361 2:209374571-209374593 CAACCATTGTGAAGACAGTGTGG + Intergenic
945739259 2:213641113-213641135 CAACCACTGTGGGGAATGTGGGG + Intronic
946429259 2:219615943-219615965 GAGCCAAGGTGGAGACAGTGAGG + Intronic
947362524 2:229360799-229360821 TAACCAGTGTGGACACAGAGTGG - Intronic
947459546 2:230291828-230291850 CAGCCACTGTGGAAACACTTTGG - Intronic
947695961 2:232189154-232189176 CAACCACTCTGGAAACACTTTGG + Intronic
947715292 2:232336077-232336099 CAACCACAGTGGAGAGAGGAGGG + Intronic
947720803 2:232368164-232368186 CAACCACAGTGGAGAGAGGCGGG + Intergenic
947734339 2:232446874-232446896 CAACCACAGTGGAGAGAGGCAGG + Intergenic
948712381 2:239833229-239833251 CAGCCACGGAGGAGAGAGTGGGG + Intergenic
948975829 2:241463318-241463340 GAACCACTGTGGGAAGAGTGTGG - Exonic
1169209320 20:3756936-3756958 AAACCAGTGTGGACACGGTGAGG + Intronic
1170118931 20:12891756-12891778 CAGACAATGTGGAGACAGCGTGG - Intergenic
1171378329 20:24711228-24711250 CAACTGCTGTGGAAACAGTTTGG - Intergenic
1172203887 20:33148265-33148287 CGTCCACTGTGGAGCCACTGAGG - Intergenic
1173656007 20:44700783-44700805 CAGCCACTGTGGCCACAATGGGG + Intergenic
1174676378 20:52360987-52361009 AAACCACTATGGAGACATGGAGG + Intergenic
1176367597 21:6043282-6043304 CAACAACTGTGCAGTAAGTGTGG - Intergenic
1177507336 21:22035795-22035817 CAGCCACTGTGGAAACAGTTTGG - Intergenic
1178360127 21:31942307-31942329 CAAGCACAGAGGAGACAGAGGGG - Intronic
1179048459 21:37868130-37868152 CCAGCACTATGGGGACAGTGGGG + Intronic
1179755922 21:43495260-43495282 CAACAACTGTGCAGTAAGTGTGG + Intergenic
1179817908 21:43919709-43919731 CAACCACTGTGGAAACAGCATGG - Intronic
1179948113 21:44693739-44693761 CAACCACTGCGGAAACATTTTGG + Intronic
1181296524 22:21844358-21844380 CAGCCACTTTGGAAACAGTATGG + Intronic
1181429507 22:22870199-22870221 GAACCAATGTGGAGACTCTGAGG + Intronic
1182207216 22:28640785-28640807 CAACCACTGTGGAAATAGTACGG + Intronic
1184532021 22:45062155-45062177 GGGCCACAGTGGAGACAGTGTGG + Intergenic
1185111865 22:48904782-48904804 CAAAGACAGTGAAGACAGTGGGG - Intergenic
949211073 3:1502089-1502111 CAACCACTATGGAAACAGTGTGG + Intergenic
949429132 3:3954030-3954052 CAGCCATTGTGGAAACAGTATGG - Intronic
949876548 3:8629628-8629650 GAACCACTGGTGAGTCAGTGAGG - Intronic
950175294 3:10869301-10869323 CAACATCTGGGCAGACAGTGTGG + Intronic
950529696 3:13546130-13546152 CAGCCACAGTGGGGGCAGTGTGG - Intergenic
950633648 3:14300135-14300157 CAACCACTGCTGAGAGTGTGGGG + Intergenic
950679589 3:14575783-14575805 CAAGCTCTGGGGAGACAGGGCGG - Intergenic
951052527 3:18110467-18110489 CAACCATTGTGGAAGAAGTGTGG + Intronic
951346725 3:21555785-21555807 CAACCATTGTGAAGACAGTGTGG - Intronic
951410872 3:22364663-22364685 CAGCCACTGTGGAAACAGTATGG + Intronic
951636688 3:24786559-24786581 AAACCACTTTGGAGATAGGGAGG - Intergenic
952597228 3:35032619-35032641 CAACCCTTGTGGGGTCAGTGTGG - Intergenic
952692922 3:36230932-36230954 CAAGCACTGAGGATAGAGTGAGG + Intergenic
953801886 3:46031006-46031028 GAACCACTGTGGGGAAAATGCGG + Intergenic
954486371 3:50856257-50856279 CAACCATTGTGAAGACAGTGTGG - Intronic
955227371 3:57072187-57072209 CAGCCACTTTGGAAACAGTTTGG + Intronic
955450345 3:59059426-59059448 CAAGCGCTGTGGAAACAGTGTGG - Intergenic
955872102 3:63450238-63450260 CTACCACAGTAGAGAGAGTGCGG + Intronic
956990655 3:74759460-74759482 CAACCACTATGGAAACAGTGTGG + Intergenic
958155809 3:89754145-89754167 CAACCACACAGGAGACAGAGGGG + Intergenic
958569944 3:95865943-95865965 CAACCATTCTGGAGTCAGTGTGG + Intergenic
958661869 3:97078930-97078952 CAGCCATTGTGAAGACAGTGTGG + Intronic
958775543 3:98478555-98478577 CAACCATTGTGGAAGCAGTGTGG - Intergenic
958889795 3:99770753-99770775 CAGCCACTGGGGAAACAGCGCGG + Intronic
959213409 3:103418536-103418558 CAACCATTGTGGAAGCAGTGTGG + Intergenic
959233851 3:103692611-103692633 AAACAATTGTGGACACAGTGTGG + Intergenic
960662583 3:120077089-120077111 CAGCCACTCTGGAAACAGTATGG + Intronic
960786439 3:121377739-121377761 CAACCATTGTGGAAACAGTGTGG + Intronic
961833751 3:129639653-129639675 CAGCCACTTTGGAAACAGTCTGG + Intergenic
961910218 3:130307171-130307193 CAACCACTATGGAAACATTATGG + Intergenic
962073703 3:132058186-132058208 AAACCCATGTGGTGACAGTGAGG + Intronic
962180581 3:133201872-133201894 CAACCATTTGGAAGACAGTGTGG - Intronic
962959627 3:140298733-140298755 CAGCAACTGTGGATGCAGTGGGG + Intronic
963110387 3:141683375-141683397 CAGCCTCAGTGGAGACAGTGAGG - Intergenic
963593201 3:147289034-147289056 GAAACACTGTGGCAACAGTGAGG + Intergenic
963612350 3:147485921-147485943 CAACCATTGGGAAGACAGTGTGG - Intronic
963956182 3:151256468-151256490 CACTCCCTGTGGAGACAGGGTGG - Intronic
963976809 3:151489391-151489413 CAACCATTGGGAAGACAGTGTGG + Intergenic
964601815 3:158510004-158510026 CAATCACTTTGGAAACAATGTGG - Intronic
964916564 3:161848356-161848378 AAACCACTGAGCAGACACTGAGG - Intergenic
965444456 3:168757696-168757718 CAACCATTGTGGAAACAGTGTGG - Intergenic
965622556 3:170655752-170655774 CAGCCAGTGTGGAAACAGTGTGG - Intronic
965653323 3:170956165-170956187 TAACCGTTGTGAAGACAGTGTGG - Intergenic
965975028 3:174610734-174610756 CAACCATTGTGCAATCAGTGTGG + Intronic
967712777 3:192727968-192727990 CAAGCAATGTGAAGTCAGTGGGG - Intronic
968737181 4:2303615-2303637 CCCCCACTCTGGAGACAGGGAGG - Intronic
969389719 4:6882494-6882516 CAAAGACTGTGGAGTCATTGAGG + Exonic
969643037 4:8410655-8410677 GAAACACTGTGGATACACTGTGG + Intronic
969837657 4:9856531-9856553 CAGCCACTGTGGAAGCAGTTTGG + Intronic
970271759 4:14355504-14355526 CAATCACTGTGGAAAATGTGGGG + Intergenic
971042503 4:22769466-22769488 CAACCATTGTGGAAACAGTGTGG - Intergenic
972204131 4:36750558-36750580 TAACCACTGTGGGAACAGTTTGG + Intergenic
972255059 4:37345293-37345315 CAGCCACTTTGGAAACAGTCTGG - Intronic
972842822 4:42951690-42951712 CAACCATTGTGGAAGAAGTGTGG - Intronic
973336092 4:48958164-48958186 CAACTACTGAGGAGAGTGTGTGG + Intergenic
973529863 4:51825489-51825511 CAACCATTGTGAAGACAGTGTGG - Intergenic
974815747 4:67001225-67001247 CAACCACTATGGAAAACGTGTGG - Intergenic
976336066 4:83888526-83888548 CAACCACTATGGAAACAGTATGG - Intergenic
976691656 4:87874537-87874559 CTACCACTCTGGAGACAGCAAGG - Intergenic
976796875 4:88944113-88944135 CAACTACTTTGAAGACTGTGTGG + Intronic
976994792 4:91417260-91417282 CAACCATTGTGGATACAGTGTGG + Intronic
977521471 4:98089625-98089647 CAACCATTGTGGAAACAGTGTGG - Intronic
977735005 4:100403646-100403668 CAATCACTGTGGAAACAGCCTGG - Intronic
977741864 4:100494053-100494075 CATCCAATGTGGAGAAACTGGGG - Intronic
977914188 4:102572528-102572550 CAGCCACTGTGGAAGCAGTGTGG - Intronic
978662597 4:111146656-111146678 CAGCCACTGTTGAAACAGTTTGG - Intergenic
978744904 4:112181914-112181936 GAACCACTGTGGCTACATTGTGG + Intronic
979532915 4:121788122-121788144 CATCCACTGGGGAGACAGGTGGG - Intergenic
980072801 4:128261283-128261305 CAACCACTGTGGTGGGAGGGGGG - Intergenic
980212633 4:129809373-129809395 CAACCACTTTGGAAACAGTGTGG - Intergenic
980580648 4:134745846-134745868 CAACCACTATGGAAAAAGTGTGG + Intergenic
981756918 4:148149966-148149988 CAACTGCTGTGGAAAGAGTGTGG + Intronic
981984659 4:150839306-150839328 CAACCATTGTGAAGACAGTGTGG + Intronic
982422392 4:155212354-155212376 CAAACAATCTGGAGACATTGAGG + Intronic
982778966 4:159470319-159470341 CAGTCATTGTGGAGGCAGTGTGG + Intergenic
983319233 4:166174795-166174817 TAGCCACTGTGGAGACAGGCAGG + Intergenic
983563306 4:169123434-169123456 CAACCACTTTAGCTACAGTGTGG - Intronic
984043079 4:174761724-174761746 AAACTACTATGGAGACTGTGAGG + Intronic
986394395 5:7314220-7314242 CAACCATTGTGGACATTGTGGGG - Intergenic
987501312 5:18713072-18713094 CAGCTACTATGGAAACAGTGTGG - Intergenic
988465616 5:31488719-31488741 GAGACACTGTGGAAACAGTGTGG + Intronic
988466157 5:31494654-31494676 CAGCCACTTTGGAAACAGTTTGG + Intronic
988566087 5:32320824-32320846 CCACCACTGTGGCGAGGGTGTGG - Intergenic
989278965 5:39620289-39620311 GTACAACTGTGGAAACAGTGTGG - Intergenic
989823099 5:45819413-45819435 CAACCATTGTGAAGACATTGTGG - Intergenic
990035188 5:51310051-51310073 CAACCATTGTGAAGTCAGTGTGG + Intergenic
992018801 5:72602254-72602276 CAGCCTCTGTGGAAACAGTCTGG - Intergenic
992383342 5:76260018-76260040 CGACCATTGTGGAAGCAGTGTGG - Intronic
992967093 5:82013578-82013600 CAACCACTATGGAAAACGTGTGG - Intronic
993467326 5:88265323-88265345 CACACATTGTGGAGGCAGTGTGG + Intronic
993811257 5:92479475-92479497 TACCCAATGTGAAGACAGTGAGG - Intergenic
994802706 5:104399344-104399366 AAACCATTGTGGAAACAGTGTGG + Intergenic
995003505 5:107163359-107163381 CAACCATTGTGGAAACAGTATGG + Intergenic
995293227 5:110485052-110485074 TAGCCACTATGGAAACAGTGTGG + Intronic
995293295 5:110485889-110485911 CAGCTACTATGGAAACAGTGTGG - Intronic
995664930 5:114531219-114531241 CAACCGTTGTGGAAACAGTGTGG - Intergenic
995665882 5:114541575-114541597 CAACCATTGTAGAAGCAGTGTGG - Intergenic
997112822 5:131093886-131093908 CAGCCACTGTAGAGACAGCTTGG - Intergenic
997907356 5:137831781-137831803 CAGCCTCTGTGGAAACAGTCTGG + Intergenic
998224829 5:140318831-140318853 CAAACATTATTGAGACAGTGAGG + Intergenic
999052617 5:148539789-148539811 CAACCATTGTGGAAACACTATGG + Intronic
1000446784 5:161331817-161331839 CAATCACTGTGGTGACAGTGTGG + Intronic
1001929552 5:175663246-175663268 CAACCTCTTTGGAAACAGTTTGG - Intronic
1002972156 6:2034907-2034929 CAACCACTTTTGAGACCATGAGG + Intronic
1002982830 6:2158830-2158852 TAACCACCGTGGACACTGTGGGG - Intronic
1003341877 6:5229258-5229280 CAATCACTTTGGAAACAGTGTGG + Intronic
1003972099 6:11309571-11309593 CGACCACTTTGGAAACAGTTTGG - Intronic
1004922026 6:20384765-20384787 CAGCCACTTGGGAGACAGAGAGG - Intergenic
1005791699 6:29309455-29309477 CAACCATTGTGGAAACAGTGTGG - Intergenic
1006328089 6:33369076-33369098 AAACCACTGTGGAGACCATTTGG + Intergenic
1006630050 6:35424453-35424475 GCACCACAGTGGAGACCGTGCGG + Exonic
1007161472 6:39794660-39794682 CAAAAACTTTGGAGACAGTCGGG - Intronic
1008661867 6:53677012-53677034 CAACCATGGTGGAGAAAGTTTGG + Intergenic
1008801542 6:55374321-55374343 CGACCATTGTGAAGACAGTGTGG - Intronic
1009326548 6:62356902-62356924 CAGCCACTGTGGAAGCAGTTTGG + Intergenic
1009725518 6:67531977-67531999 CAACCATTGTGAAGACAGTGTGG + Intergenic
1009794568 6:68450839-68450861 CAACCATTGTGGACACAGTGTGG - Intergenic
1010036969 6:71337203-71337225 CAACCATTGTGAAAATAGTGTGG + Intergenic
1010563637 6:77382390-77382412 CAACCACTGTGGAAAAAGTTTGG + Intergenic
1011216482 6:85011492-85011514 GAACCATTTTGGAGAAAGTGGGG - Intergenic
1011680756 6:89780993-89781015 CAACCACTGAGAACACAGAGTGG + Intronic
1012232137 6:96772477-96772499 CAACCATTGTGGAAGTAGTGTGG + Intergenic
1012590554 6:100974949-100974971 CAACCATTGTGAAGACAGTGTGG + Intergenic
1012701369 6:102461053-102461075 CAACCATTGTGGAAGAAGTGTGG + Intergenic
1013319737 6:108975577-108975599 CAACCATTGGGAAGACAGTGTGG - Intergenic
1014148611 6:118027363-118027385 CAGCCACTGTGGAAACAGTTTGG - Intronic
1014944207 6:127477575-127477597 CAACCACTGGTGAGAAGGTGAGG + Intronic
1016198157 6:141371971-141371993 CAACTACAGTAGAGACAGTGAGG - Intergenic
1016412391 6:143796982-143797004 CAACCATTTGGAAGACAGTGTGG - Intronic
1016488778 6:144572969-144572991 CAACTATTGTGAAGACAGTGTGG - Intronic
1016620177 6:146099941-146099963 CATGCACTCTGGAAACAGTGTGG - Intronic
1017612881 6:156209919-156209941 TAACCACTATGGAAACAGTATGG - Intergenic
1018690225 6:166338662-166338684 CAAGCACTGGGGAGAGGGTGGGG + Intronic
1019172595 6:170142160-170142182 CAGCCATTGTGGAAACAGTCTGG - Intergenic
1020970275 7:14929305-14929327 CAACCTCTATGAAAACAGTGTGG - Intronic
1021427935 7:20524279-20524301 CAACCATTGTGAAAGCAGTGTGG + Intergenic
1022777499 7:33543033-33543055 CAACCACTATGGAAACAGTGTGG - Intronic
1022779786 7:33568608-33568630 AAACCACTATGGAAACAGTAAGG - Intronic
1023159163 7:37280769-37280791 TAGCCACTGTGGAAACAGTGTGG + Intronic
1023748296 7:43343829-43343851 CAACCATTGTGGAGACAGTGTGG - Intronic
1023763928 7:43493244-43493266 ACACCTCTGTGGAGACAGAGCGG + Intronic
1024121055 7:46240890-46240912 CAGCCACTCTAGAGACAGTTTGG + Intergenic
1024280775 7:47717748-47717770 TAACCACTGTGGAAACAGTCTGG + Intronic
1024889119 7:54181028-54181050 GAACTTATGTGGAGACAGTGGGG + Intergenic
1026451567 7:70533942-70533964 CAACCATTGTGTAGGCAGAGTGG - Intronic
1027219936 7:76207425-76207447 CAACCACTTTGAACACAGTATGG + Intronic
1027949425 7:84795325-84795347 CAGCCACTGTGGAAATAGTTTGG - Intergenic
1028409186 7:90509421-90509443 CACCCACAGTGGAGACTTTGGGG - Intronic
1028896997 7:96053039-96053061 CAACTACTGTGGAGATAGGAGGG - Intronic
1029257698 7:99280586-99280608 AAACCACTGGGGATACAGTCAGG + Intergenic
1030624220 7:111826360-111826382 CAGGCATTGTGGAGACACTGAGG + Intronic
1030921712 7:115397663-115397685 CCATCACTGGGGAGACAGTTGGG + Intergenic
1031116196 7:117671487-117671509 CAGCCACTTTGAAGACAGTTTGG - Intronic
1032861301 7:135882346-135882368 CAGCCACTGTGGAAACAGTCTGG + Intergenic
1033013946 7:137652546-137652568 CACCCAGAGTGCAGACAGTGTGG - Intronic
1035075195 7:156173231-156173253 CAATCACTGTGGGGACAGCCTGG - Intergenic
1035885726 8:3289398-3289420 CAACCATTGTGAAGTCAGTGTGG - Intronic
1037257460 8:16971387-16971409 CAACCATTGTGAAGTCAGTGTGG + Intergenic
1038599336 8:28923679-28923701 CAGCCACTGTGTAAACAGTTTGG - Intronic
1039180897 8:34864835-34864857 CATCTAGTGTGGTGACAGTGAGG - Intergenic
1039748041 8:40449893-40449915 CAGCCACTATGAAAACAGTGTGG - Intergenic
1040084697 8:43327242-43327264 CAACCACGTCGAAGACAGTGTGG - Intergenic
1040339651 8:46434050-46434072 CAACAACTCAGGAGACATTGAGG + Intergenic
1040961557 8:53038989-53039011 CAACCATTGTGGAAGCAGTATGG - Intergenic
1041301119 8:56412390-56412412 CAACCACATGGAAGACAGTGTGG - Intergenic
1041556870 8:59167497-59167519 CAACCCCTGTGGAAACAGTATGG - Intergenic
1041886884 8:62820035-62820057 GAACCAAGGTGGGGACAGTGAGG + Intronic
1042020112 8:64363864-64363886 CTACCACTTTGGAGAAACTGTGG + Intergenic
1042374163 8:68029711-68029733 CACCCACTGTCTAGACAGTTGGG - Intronic
1042986592 8:74590653-74590675 CAGCCACTGTGGAAACTGTGTGG + Intergenic
1043471059 8:80562970-80562992 CAACCACTTTGGAAAACGTGTGG - Intergenic
1043763396 8:84098168-84098190 CAACCATTGTGGAAACAGTGTGG - Intergenic
1044120769 8:88391980-88392002 CAACCATTTGGAAGACAGTGTGG - Intergenic
1045937561 8:107698406-107698428 AAAACAATGTGAAGACAGTGTGG - Intergenic
1046425125 8:114037049-114037071 CAACCGCTGTGGAAAAAGTATGG + Intergenic
1046730599 8:117721672-117721694 CAACCTCTATGGAAACAGTATGG - Intergenic
1046931770 8:119848538-119848560 CAGCCACTCTGGAAACAGTACGG + Intronic
1046957027 8:120072328-120072350 CAGCCACTGTGGTGAGTGTGTGG + Intronic
1047787799 8:128170631-128170653 CAGCCACTGATGAGACACTGTGG + Intergenic
1048756056 8:137739309-137739331 CAATCATTGTGGAAACAGTGTGG - Intergenic
1049403300 8:142440515-142440537 TCACCACTGTTGACACAGTGAGG + Intergenic
1050277404 9:4014196-4014218 AAACCAGTGTGGAGAGAATGGGG + Intronic
1050403486 9:5282198-5282220 CAACCATTGTGGAAGCAGAGTGG + Intergenic
1051228405 9:14927417-14927439 AAACTACTCTGAAGACAGTGGGG - Intergenic
1051848548 9:21480488-21480510 CAACCACTATGGAGGCAATTAGG - Intergenic
1052303990 9:26984874-26984896 CAACCACTGTGAAAGCAGTGTGG + Intronic
1052918478 9:33942870-33942892 CAGCCACAGTGGAAACAGTATGG + Intronic
1053387002 9:37700271-37700293 CATTCACTGTGGAGATTGTGAGG - Intronic
1057406710 9:94778213-94778235 CAACCACTTTGGAAATAGTTTGG + Intronic
1058029778 9:100182698-100182720 CAACCTTTGTGAAGACAGTGTGG + Intronic
1058147893 9:101431632-101431654 CAACCACTGTGGAGGCTGCTTGG - Intronic
1058237490 9:102509511-102509533 CAGCCACTATGGAAACAGTATGG + Intergenic
1058513482 9:105745159-105745181 CAACCATTGTGAAGACAGTGTGG - Intronic
1058516951 9:105785640-105785662 CAACCATTGTGAAGACAGTGTGG - Intergenic
1058552669 9:106132204-106132226 GACCCACTGTGAAGACAGTGGGG - Intergenic
1058832152 9:108828397-108828419 CAACCACTATGGAAAAAGTGTGG + Intergenic
1059129998 9:111737129-111737151 CAGCCACTGTGGAAACTGTTTGG + Intronic
1059226442 9:112677449-112677471 CACCCTCTGTGGAAACAGTATGG - Intergenic
1061025477 9:128046004-128046026 CAACCACATTGGAAACAGTGTGG + Intergenic
1061470386 9:130820401-130820423 CCAGCACAGTGAAGACAGTGAGG - Intronic
1061784828 9:133021215-133021237 CAGCCACTGTGGAAACAGTATGG - Intergenic
1061875688 9:133542469-133542491 CAGGCACTGTGCACACAGTGAGG + Intronic
1062355027 9:136157886-136157908 CAGCCACTGTGGAGAGGGTGGGG + Intergenic
1062619668 9:137414529-137414551 CGTCCACTGTGGAAACAGTCTGG - Intronic
1203776956 EBV:78449-78471 CATCCGCGGTGGATACAGTGGGG + Intergenic
1203398222 Un_KI270519v1:47952-47974 CAACGATTGTGAAGTCAGTGTGG + Intergenic
1185772016 X:2772005-2772027 CAACCACTTTGGAAGCATTGGGG + Intronic
1185926481 X:4152788-4152810 CAACCTCTATGGAAACAGTTTGG - Intergenic
1186681645 X:11881218-11881240 CAGTCACTTTGGAGACAGTTTGG + Intergenic
1186880519 X:13861382-13861404 CAACCACTATAGAAATAGTGGGG - Intronic
1187157281 X:16732823-16732845 CATCCGCTGGGGATACAGTGGGG + Intronic
1188134402 X:26476895-26476917 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1188246668 X:27843161-27843183 CAGCCACTTTGGAAACAGTTTGG - Intergenic
1188262561 X:28037384-28037406 CACCCAATGTGGAGGCAGTCTGG + Intergenic
1188319698 X:28721166-28721188 CAACCATTGTGGAAGCAGTGTGG - Intronic
1188393498 X:29651190-29651212 CAGCCATTATGGAGACAGTATGG + Intronic
1188825729 X:34832095-34832117 AAACCTCTGTGGAAATAGTGTGG + Intergenic
1189604248 X:42659785-42659807 CAGCCACTATGGAAACAGTGTGG + Intergenic
1189682355 X:43529738-43529760 CAACATCTGTGGGGAAAGTGAGG + Intergenic
1189873067 X:45404619-45404641 CAGCCAGTGTTTAGACAGTGGGG + Intergenic
1190369331 X:49726586-49726608 CCACCACTGTGGGGAGGGTGTGG + Intergenic
1190551593 X:51587557-51587579 CAACCACGTGGAAGACAGTGTGG - Intergenic
1190765261 X:53470866-53470888 CAGCCACTGTGGAAACAGTTGGG - Intergenic
1191130323 X:57001156-57001178 CAGCCACAGTGGAAACAGTTTGG - Intergenic
1191163210 X:57357754-57357776 CAACCATTGTGAAGACAGTGTGG + Intronic
1191819696 X:65291212-65291234 CAACCACTATGTAAACAGTATGG + Intergenic
1192686404 X:73310412-73310434 CGACCATTGTGGATACAGTGTGG + Intergenic
1193308860 X:79981253-79981275 CAACCACTGTGAAAGCAGTTTGG - Intergenic
1193327428 X:80196029-80196051 CAAGCATTGTGAAGACAGTGTGG + Intergenic
1193403177 X:81070075-81070097 CAACCATTGTGGAGTCAGCGTGG + Intergenic
1193452798 X:81691284-81691306 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1193609825 X:83617242-83617264 CAATCACTATGCAGACAGTTTGG - Intergenic
1193779468 X:85684708-85684730 CAGACACTATGGAAACAGTGTGG - Intergenic
1193901066 X:87177950-87177972 CAACCATTGAGAAGACAGTGTGG + Intergenic
1193995818 X:88365132-88365154 CAACCACTGTAGACACAGCTGGG + Intergenic
1194246259 X:91515336-91515358 CAGTCACTGTGGAAACAGTCTGG + Intergenic
1194378097 X:93160911-93160933 CAACCAGTGTGGAAACAGTATGG + Intergenic
1194633542 X:96316142-96316164 CAACCACTATGGAAACAGTGTGG - Intergenic
1194891587 X:99385207-99385229 CATGCTCTGTGGAGCCAGTGGGG - Intergenic
1195223867 X:102772259-102772281 CAACCACTTTGAAAACAGTTTGG - Intergenic
1195234726 X:102885516-102885538 CAACCACTTTGAAAACAGTTTGG - Intergenic
1195288352 X:103407391-103407413 CAACCACTTTGGAAACAGCTTGG - Intergenic
1196152153 X:112386928-112386950 CAACCACTTTGGAAACGGTGTGG - Intergenic
1196260694 X:113577040-113577062 CAACCACTATGGAAACAGTGTGG - Intergenic
1196693391 X:118584620-118584642 AAACCACTTTGGAAACAGTTTGG - Intronic
1197009817 X:121546703-121546725 CCACCACTGCAGACACAGTGGGG + Intergenic
1197038841 X:121909516-121909538 CAACAACTGTGGAAACAATTTGG - Intergenic
1198054764 X:132982967-132982989 CAACTACTGTGGGGAAACTGAGG - Intergenic
1198328684 X:135600762-135600784 CATCCACATGGGAGACAGTGTGG - Intergenic
1198652550 X:138878723-138878745 CAACCATTGTGAAGTCAGCGTGG - Intronic
1199246229 X:145607636-145607658 CAGCCACTATGGAAACAGTGTGG + Intergenic
1199527014 X:148804030-148804052 GAACCACTGAGGAGATAGTTTGG - Intronic
1200133796 X:153864989-153865011 CATCCACTGTGGGGACAGACAGG + Exonic
1200534126 Y:4373784-4373806 CAATGACTGGTGAGACAGTGAGG - Intergenic
1200565224 Y:4756585-4756607 CAGTCACTGTGGAAACAGTCTGG + Intergenic
1201298627 Y:12487138-12487160 CAACCACTTTGGAAGCATTGGGG - Intergenic
1201552236 Y:15229678-15229700 CCTCCACTCTGGACACAGTGTGG - Intergenic
1202329537 Y:23732637-23732659 CAACCATTTGGAAGACAGTGTGG + Intergenic
1202541234 Y:25937417-25937439 CAACCATTTGGAAGACAGTGTGG - Intergenic