ID: 1100665363

View in Genome Browser
Species Human (GRCh38)
Location 12:96746308-96746330
Sequence CCTTCCAGCCAGACTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100665361_1100665363 0 Left 1100665361 12:96746285-96746307 CCTCTGTCATTCTCACAAAACAT 0: 1
1: 0
2: 1
3: 22
4: 265
Right 1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG 0: 1
1: 0
2: 0
3: 10
4: 140
1100665360_1100665363 11 Left 1100665360 12:96746274-96746296 CCTACTGTAAGCCTCTGTCATTC 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100665363 Original CRISPR CCTTCCAGCCAGACTCCTTA AGG Intronic