ID: 1100665363

View in Genome Browser
Species Human (GRCh38)
Location 12:96746308-96746330
Sequence CCTTCCAGCCAGACTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100665361_1100665363 0 Left 1100665361 12:96746285-96746307 CCTCTGTCATTCTCACAAAACAT 0: 1
1: 0
2: 1
3: 22
4: 265
Right 1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG 0: 1
1: 0
2: 0
3: 10
4: 140
1100665360_1100665363 11 Left 1100665360 12:96746274-96746296 CCTACTGTAAGCCTCTGTCATTC 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100665363 Original CRISPR CCTTCCAGCCAGACTCCTTA AGG Intronic
901631866 1:10651959-10651981 CCTTCCAGCCAGGTGCCTGATGG - Intronic
902062097 1:13654068-13654090 AATTCCAGCCAGCCTCCATATGG + Intergenic
902228000 1:15008842-15008864 CCTGCCAGCCACAGTCCTCAAGG + Intronic
903223529 1:21882114-21882136 CTTTGCAGCCAGACTTCTCAGGG + Intronic
904673749 1:32184758-32184780 ACTTCCAGCCAGCCTCTTCAGGG + Intronic
905128952 1:35737407-35737429 CTTTCCAGCCAGTCGCCCTATGG - Exonic
905253313 1:36664181-36664203 CCTTCCAGCCACCCTCCCCATGG - Intergenic
907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG + Intronic
909880219 1:80866193-80866215 CCAACCTGCCAGAGTCCTTATGG - Intergenic
912449488 1:109760445-109760467 CCTTCCACCCAGGCTTCTTGTGG + Intronic
915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG + Intergenic
921628997 1:217411478-217411500 CTTTCCAGTATGACTCCTTACGG + Intergenic
1063109373 10:3021193-3021215 CTTTCCCGCCAGACTCTTTGTGG + Intergenic
1066030405 10:31417221-31417243 CTTTCATGCCAGTCTCCTTATGG + Intronic
1067273279 10:44811119-44811141 CCTTCCAAACAGACTCCACATGG - Intergenic
1072405478 10:95148083-95148105 CCTTCCAGTTAGGCTCCTCAGGG - Intergenic
1072631513 10:97150115-97150137 CCTTCCTGCCAGAGTCCTCTGGG - Intronic
1076200192 10:128551857-128551879 CCATGCAGCCAGTCTCCCTAAGG + Intergenic
1076674173 10:132139778-132139800 CCTTCCAGCAAAACTCCCTCAGG - Intronic
1077423963 11:2465856-2465878 CCTGCCAGCCAGGCTCCAAATGG - Intronic
1081267390 11:41042478-41042500 CTTTCCACCTACACTCCTTATGG - Intronic
1081541936 11:44040854-44040876 CCTTCCAGGGAGAGGCCTTAAGG + Intergenic
1084144307 11:67256006-67256028 CCTCCCAGCCAGGCTCCTCCAGG + Exonic
1086755271 11:90553656-90553678 ACTTCAAGTCAGACTCCTGAGGG - Intergenic
1091787496 12:3251948-3251970 GCTTCCACCCAGACTTCTCATGG + Intronic
1092860352 12:12714912-12714934 GCTGGCAGCCAGACTTCTTAAGG + Intergenic
1099759020 12:86893928-86893950 CCTCCCAGCCATCCTCTTTAGGG + Intergenic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101252712 12:102951295-102951317 GCTACCAGGGAGACTCCTTACGG + Intronic
1103732440 12:123036825-123036847 CCTCCTAGCAAGAGTCCTTATGG - Intronic
1105003030 12:132703441-132703463 ACATCCACCCTGACTCCTTAGGG - Intronic
1106917002 13:34526566-34526588 CTTTCCTCCCAGACTCCTGAGGG + Intergenic
1109405385 13:61891517-61891539 CCTTCCAGCCAACCTCATCAAGG + Intergenic
1114402271 14:22420847-22420869 CCTTCCCTCCAGTCTCCTGAAGG + Intergenic
1115345037 14:32333906-32333928 CATTCCAGCCAGCCTGCTGATGG + Intronic
1115775619 14:36711558-36711580 CCTTCAAGCCAGAATTATTAGGG + Intronic
1118813090 14:69289631-69289653 CCTTCCAGGAAGACTCCTGGTGG - Intronic
1120656087 14:87191529-87191551 TATTCAAGCCAGGCTCCTTAAGG + Intergenic
1121210856 14:92207221-92207243 CCCTCCAGCCAAACTCCCTCAGG - Intergenic
1122217249 14:100212597-100212619 CCTTCCGACCAGGCTCCTGAGGG - Intergenic
1202830070 14_GL000009v2_random:18606-18628 CCTTCATGCCTGACTCCTTTTGG + Intergenic
1124141315 15:27079615-27079637 GCTTCCTGCCAGACTCCTTCAGG - Intronic
1124578798 15:30933114-30933136 ACCTCCTGCCAGACTCATTAGGG - Intronic
1125261353 15:37829103-37829125 CCTTCTTTCCAGACTACTTAGGG - Intergenic
1125722168 15:41850544-41850566 CCTTCCTGCCAGAATCCTCATGG - Intronic
1125792188 15:42375356-42375378 CTGAGCAGCCAGACTCCTTACGG + Intronic
1126121695 15:45258484-45258506 CCTTTCAGTCAGCCTCCCTAAGG + Intronic
1126195697 15:45928008-45928030 ATTTCCAGCCAGCCACCTTATGG + Intergenic
1130050678 15:80481075-80481097 CTTTCCAGCCAGATCCCTTGGGG - Intronic
1130311952 15:82764019-82764041 CCTTACAGCAAAACTCCTGATGG - Intronic
1132552235 16:558309-558331 CCTCCCTGCCAGAGTCCTTCCGG + Intergenic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136478858 16:30529085-30529107 ACTTCCAGCCAGCCTCCTCTAGG + Intronic
1138018833 16:53457808-53457830 GCTTCCTGCCAGAGTCCTCAAGG - Intronic
1140314579 16:73882719-73882741 CTTTCCAGCCAGATTCTTAATGG + Intergenic
1141462695 16:84187090-84187112 CCTCCCAGCCAGGCCTCTTAGGG + Intergenic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1142880089 17:2877338-2877360 CCTTTCAGCCAGCCTCCCTGCGG + Intronic
1147722466 17:42547493-42547515 CCTTGAAGGCAGGCTCCTTAGGG + Intergenic
1148890867 17:50806151-50806173 CTTTCAAGCCAGAGTCCTCACGG - Intergenic
1150983759 17:70171849-70171871 CCTTCCAGCCAAAATATTTAAGG - Intronic
1152670283 17:81600045-81600067 CCTTCCAGCCACACTTCATGAGG - Intronic
1154341075 18:13502849-13502871 GCTGCCAGCCAGACTGCTTCAGG - Intronic
1157880824 18:51319673-51319695 CCTTCCACCCAGACTACTGGTGG - Intergenic
1158435165 18:57430318-57430340 ACTTCCACCCAAACTCCTCACGG + Intergenic
1158675873 18:59517762-59517784 CCTTCCAGCCTAACTGCTAATGG - Intronic
1160743989 19:701983-702005 CCTTCCAGCCAGACTGGAGAGGG + Intergenic
1161622834 19:5308368-5308390 TCGTCCCCCCAGACTCCTTAAGG + Intronic
1162856871 19:13475438-13475460 CCTTCCGGACAGAAGCCTTAAGG - Intronic
1165393517 19:35551446-35551468 CCTTCCAGCAAGGCTTCTTCAGG - Exonic
1167318346 19:48779799-48779821 ACTTCCAGCCACACCCATTAGGG - Intergenic
1168124927 19:54277860-54277882 CCTTCGAGCCAGAGGCCTCAGGG + Intronic
925487187 2:4348458-4348480 CCCTCCATCCAGTCTCCCTATGG + Intergenic
933762853 2:85685196-85685218 CCTTCCAGCTGGACTCCCTTAGG - Intronic
934520279 2:95015890-95015912 CTTTCCAGACAGATTTCTTAGGG + Intergenic
936519428 2:113202319-113202341 CCTGCCAGGCAGACCCCTAAGGG - Exonic
938473269 2:131585728-131585750 CCTGCCAACCAGTCTCCTGAAGG - Intergenic
943998425 2:194801373-194801395 CATTACTGCCAGACTCCCTATGG + Intergenic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
949017824 2:241723413-241723435 CCAGCCAGCCACACTCCTTGAGG - Intronic
1171962476 20:31504659-31504681 CCTGCCAGCCAGGGTGCTTAGGG + Intergenic
1176609256 21:8863446-8863468 CCTTCATGCCTGACTCCTTTTGG + Intergenic
1179174140 21:38995241-38995263 CCTTCCAGTCAGCCTCCTGCGGG - Intergenic
1179712937 21:43273504-43273526 CCCTCCAGCCTGGCTACTTAGGG - Intergenic
1181134072 22:20751964-20751986 CCTGCCAGCCCCACTTCTTAGGG + Intronic
1181636407 22:24176782-24176804 CCAACCAGCCAGACCCCTTGGGG + Intronic
1182127415 22:27826182-27826204 CTCCCCAGCCAGACACCTTAAGG + Intergenic
1182890676 22:33816235-33816257 CCTGGAAGCCAGACTGCTTATGG - Intronic
950628350 3:14264974-14264996 CATTCCACTCAGCCTCCTTACGG - Intergenic
953754799 3:45636837-45636859 CATTCAATCCAGACTCCTGATGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966586743 3:181634718-181634740 CCTTCCCCCAAGACTCCTGAAGG - Intergenic
968111923 3:196055568-196055590 ACTTCTAGCCAAATTCCTTAAGG + Intronic
973165711 4:47075543-47075565 GCCTCCAGCCAGTCTGCTTATGG + Intronic
973389550 4:49543742-49543764 ACTGCCAGCCAGACTCCTCTTGG + Intergenic
973761258 4:54117710-54117732 GCTTCCAGCCATACTCAATAGGG - Intronic
979502414 4:121455524-121455546 CCTCCCAGCCAGGCTCGTGAAGG - Intergenic
984555933 4:181213773-181213795 CCCTCCACCCAGACTCATAATGG - Intergenic
985309670 4:188583569-188583591 CCTTCCACCCAGAGACTTTAGGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
988685755 5:33523620-33523642 CCTTCTACCCAGCCTCCTCAAGG - Exonic
996578033 5:124998334-124998356 CCATCCAGCTAGATTCCTTTTGG + Intergenic
997848259 5:137307785-137307807 CCTTCCAGGCAAAGTCCTCAAGG - Intronic
998071934 5:139204790-139204812 CCTTCCAGCCTGATTTCTTTAGG - Intronic
999187817 5:149725943-149725965 CCTTCCAGCAACCCTCCGTAGGG - Intergenic
1000139128 5:158384305-158384327 ACTTCCAGGAAGACTCCGTAAGG + Intergenic
1000960719 5:167597584-167597606 CCCACCACCCTGACTCCTTATGG - Intronic
1004330381 6:14715567-14715589 CCTTCCAGCCAGCTCCATTAGGG + Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG + Intronic
1017280420 6:152618004-152618026 CCTTCCAGATAAACTCATTATGG - Intronic
1017590436 6:155973515-155973537 CCTTTCATCCAGACTGCTTCTGG - Intergenic
1018842050 6:167524378-167524400 CCTCCCAACCAGGCTGCTTACGG - Intergenic
1019541618 7:1554293-1554315 CCTGCCTGCCAGTCTCCTGATGG + Intronic
1019728042 7:2613726-2613748 CCTTACAGCCAGGCTCCGTGCGG + Exonic
1020478569 7:8628872-8628894 CCTTGAAGCCAGACCCCGTATGG + Intronic
1022517307 7:30984162-30984184 CCTTCCAGCCAGCCTCCCCGCGG + Intronic
1023862596 7:44225238-44225260 CCTTCCAGGCAGGCTCCTTTGGG + Intronic
1024055570 7:45658030-45658052 CCTGCCAACCAGACTCCCTGTGG + Intronic
1032109961 7:129067668-129067690 TCTTCCAGCAAGGCTCCTTGTGG - Intergenic
1034972451 7:155427688-155427710 CCCCCCAGCCACACTCCCTACGG + Intergenic
1036026402 8:4913796-4913818 CCTTCCCACCAGACTCTTTGGGG + Intronic
1037510402 8:19576583-19576605 CCTGCCAGCAAGACTCGTTGGGG - Intronic
1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG + Intronic
1042790722 8:72602770-72602792 CCTTCCAGCCACTCTCATGAAGG - Intronic
1042836702 8:73085519-73085541 CCTCCCAGCCAGACTCTCCAAGG + Intronic
1043787209 8:84418309-84418331 CCTTCCATATAGACTTCTTATGG + Intronic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1049095351 8:140545239-140545261 CCTTCTAGTCAGACTTCTCACGG + Intronic
1051193379 9:14537279-14537301 CCCTCCAGCCAGTGTCCTGAGGG + Intergenic
1053306509 9:36987824-36987846 CCTGCCTGCCTGCCTCCTTAAGG + Intronic
1053512691 9:38702256-38702278 CATTCCAGCCACACTCCTGGTGG - Intergenic
1056845218 9:90031786-90031808 CCTTCCAGCCTGAATGCTTCTGG + Intergenic
1057032127 9:91783942-91783964 CTTTCCATCCTGACTCCTTGAGG + Intronic
1059778401 9:117500536-117500558 CCTTCCTGCAAGAATCCTAAAGG + Intergenic
1060414681 9:123421916-123421938 CTTTCCAGCCAGCCCCCTCACGG + Intronic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1187823004 X:23308331-23308353 CCATCCAGCCACACTCCTCTGGG - Intergenic
1192153738 X:68727780-68727802 CCTGCCAGTGAGACTCCATAGGG + Intergenic
1195416002 X:104620084-104620106 ACTTCCAGCCAAACTCCTAATGG - Intronic
1196923094 X:120604348-120604370 CCTGCCATCCTGACTCCCTAAGG + Exonic
1198472567 X:136961925-136961947 TCTTCCAGCCAAACTCCTGCTGG - Intergenic
1199563467 X:149188670-149188692 TCCTCCAGCCAGACACCATAAGG + Intergenic
1199651351 X:149947938-149947960 CTTCCCAGCCATACTACTTATGG + Intergenic
1201540393 Y:15099777-15099799 TCTTGCACCCAGACTCTTTAGGG + Intergenic
1201590722 Y:15611591-15611613 CCTCCCAGTTAGACTACTTAGGG - Intergenic