ID: 1100673003

View in Genome Browser
Species Human (GRCh38)
Location 12:96836309-96836331
Sequence CAGGGAAAACATAAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100673003 Original CRISPR CAGGGAAAACATAAGGATTG AGG Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
902657182 1:17877311-17877333 GAGGGAGAACAAAAGGATGGAGG - Intergenic
904903359 1:33875251-33875273 CAGGGCAAACATAAGGGGCGGGG + Intronic
905875905 1:41432009-41432031 CAGGGAGAACACCAGGAATGGGG - Intergenic
906880159 1:49581408-49581430 CAGGAAAAACATAAAAAATGAGG - Intronic
907228959 1:52977066-52977088 CAGGGAAAACAAAATGCTTTGGG - Intronic
908504870 1:64787036-64787058 TATGAAAAACATAAGTATTGAGG - Intronic
910331973 1:86083904-86083926 AAGGGAAAATATATGGATTTAGG - Intronic
911152268 1:94607216-94607238 CATGGAACACAAAAGGATGGGGG - Intergenic
912232254 1:107807986-107808008 CAGGCAAAACATAATAATTGCGG + Intronic
913586328 1:120278662-120278684 CAAGGAAGACAGAAGGCTTGAGG + Intergenic
913621858 1:120619708-120619730 CAAGGAAGACAGAAGGCTTGAGG - Intergenic
913650145 1:120905861-120905883 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
914076528 1:144357644-144357666 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914102650 1:144608853-144608875 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
914170975 1:145223224-145223246 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914526089 1:148467192-148467214 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914568337 1:148890519-148890541 CAAGGAAGACAGAAGGCTTGAGG + Intronic
914604488 1:149239730-149239752 CAAGGAAGACAGAAGGCTTGAGG - Intergenic
914640314 1:149599931-149599953 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
915239999 1:154514464-154514486 CAGGGGAAACACACGGAATGGGG + Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916623323 1:166525688-166525710 CAGTGAAAACACAAGTATTGTGG + Intergenic
916976707 1:170088511-170088533 TAAGGAAAACAAAAGGATAGAGG - Intergenic
918430965 1:184460254-184460276 CAGGGCAAACATTGGGATTTGGG - Intronic
918634600 1:186760005-186760027 CTGGGAGAACATCAGGCTTGGGG + Intergenic
920707007 1:208258878-208258900 CAGAGAAAACTTAAGAACTGTGG - Intergenic
920714285 1:208324998-208325020 AAGGGAAAGCATCAGGATTTAGG + Intergenic
923283191 1:232464794-232464816 AATTGAAAACATAAGGATGGCGG + Intronic
923428849 1:233900406-233900428 AAGAGACAACATAAGGAATGAGG + Intergenic
923642544 1:235779337-235779359 CAGGAAAAATAAAAGGATTAGGG + Intronic
1063016741 10:2085443-2085465 AAGGAAAAACATAAAGATTATGG - Intergenic
1063453760 10:6168949-6168971 AAGAGAAAGCATAAGGAGTGGGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065383465 10:25112399-25112421 TGGGGATAACAAAAGGATTGTGG + Intergenic
1065395547 10:25232974-25232996 CATTGAAAACAGAAGGATTAAGG + Intronic
1065527926 10:26641192-26641214 CAGGGAAAAAAGAAGGGGTGGGG - Intergenic
1065814467 10:29471662-29471684 TAGGGAAAATATATGGTTTGTGG + Intronic
1067895823 10:50178061-50178083 CAGGGAAAGCATAGTCATTGTGG + Intergenic
1067953161 10:50763924-50763946 CAGGGAAAGCATAGTCATTGTGG - Intronic
1068649855 10:59510453-59510475 AAAGGAAAAGTTAAGGATTGGGG + Intergenic
1069494390 10:68889860-68889882 CAAGGAAAAAAAAAGGCTTGAGG - Intronic
1070270359 10:74948140-74948162 CAGGGAAAACAAAAGAAGTCAGG + Intronic
1073310732 10:102539211-102539233 CATGAAAAACAGAAAGATTGAGG - Intronic
1073620448 10:105041885-105041907 TGGGAAAAACATAAGGATGGTGG + Intronic
1074767257 10:116708368-116708390 CAAGGAAACCAGAAGGTTTGAGG + Intronic
1075941982 10:126397695-126397717 CAGACAATACATAAGGACTGTGG + Intergenic
1077558510 11:3240404-3240426 CTGGGATAAGATAAGGGTTGTGG + Intergenic
1080144155 11:28959426-28959448 CAGGAAGAATATAAGTATTGGGG - Intergenic
1080392558 11:31861658-31861680 CAGGGAAAACAGACCGATTCCGG - Intronic
1086188425 11:84048887-84048909 CAGGGAAAAAAGAAGAATTTTGG + Intronic
1087344423 11:96952625-96952647 CAGAGAAAATATAAGAAATGCGG - Intergenic
1088502360 11:110495221-110495243 CTGGGAAAACATAAATTTTGAGG + Intergenic
1089698685 11:120231133-120231155 AAGGGAAAACATACTGATTTGGG - Intergenic
1090150859 11:124382680-124382702 CAATGAAAACATAAGAAATGAGG + Exonic
1090152148 11:124396688-124396710 CAATGAAAACATAAGAAATGAGG + Exonic
1090875981 11:130789429-130789451 CAGGGACATCATGAGGCTTGGGG + Intergenic
1091165429 11:133471695-133471717 GAGGTAAAACAGAAGGATTGAGG + Intronic
1092380108 12:7988918-7988940 CAGGAAAAAAAAAAGAATTGAGG - Intergenic
1093251883 12:16815827-16815849 TATGTAAAAGATAAGGATTGAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1096377696 12:51127302-51127324 AAGGGAAGACAACAGGATTGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097263083 12:57730658-57730680 GAGGGACCACATAAGGAATGGGG - Intronic
1098031769 12:66262108-66262130 TAAGGAAACCATAAGGTTTGAGG + Intergenic
1098391366 12:69972966-69972988 CTGGGAAAACACATGGATTCTGG + Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104588509 12:130066267-130066289 CAGGGACAGGATAAGGATGGGGG + Intergenic
1106318173 13:28613618-28613640 CAGGGAAGACAGGAAGATTGTGG - Intergenic
1106743827 13:32678197-32678219 GAGGGAAAACAAAAGATTTGAGG + Intronic
1108412172 13:50160755-50160777 CAGTAAAAAGATAAGGAATGGGG - Intronic
1109287183 13:60423972-60423994 GAGAGAAAACATCAGGATTTTGG - Intronic
1111033119 13:82633160-82633182 CAGGAAACGGATAAGGATTGCGG - Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1114889053 14:26893084-26893106 CAGGGAACACACATTGATTGAGG + Intergenic
1115101393 14:29705150-29705172 CAGGGATAAAATAAGGATAGTGG - Intronic
1115283621 14:31692938-31692960 CAGGGAAAAAAAAAAGAATGTGG - Intronic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1118555732 14:67018819-67018841 CAGAAAAAAAATAAAGATTGTGG - Intronic
1119116225 14:72024222-72024244 CAGTGAACACAGAAGGCTTGGGG + Intronic
1119647621 14:76359720-76359742 CAGGGAAAGCAGAGGGCTTGTGG + Intronic
1121990958 14:98556763-98556785 CAGGAAAAACATAAGAAATAGGG + Intergenic
1124428804 15:29588309-29588331 CAGGGAAAAGAAAGGGATAGAGG + Intergenic
1125190620 15:36988348-36988370 CAAGGAAAACATACTGATTTGGG - Intronic
1126297724 15:47159606-47159628 CAGGTAACACATGGGGATTGGGG + Intergenic
1126347567 15:47712336-47712358 TAGAAAAAAAATAAGGATTGAGG + Intronic
1127162088 15:56199489-56199511 CAGGGAAGGCATATAGATTGAGG - Intronic
1127501181 15:59555535-59555557 CAAGGAAAATATAAGTGTTGCGG + Intergenic
1128612319 15:69084064-69084086 CAGGGAGGACATAAGGCTGGAGG + Intergenic
1128763656 15:70237148-70237170 CAGGGAGGACTGAAGGATTGTGG + Intergenic
1129063748 15:72883504-72883526 CAGGGAAAGAATAAAGATTAGGG - Intergenic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1131005376 15:88973221-88973243 GAGGGAAAACACAAGGTCTGGGG - Intergenic
1132328904 15:100996597-100996619 CAGGGAAAACATATGGGCAGAGG - Intronic
1134766513 16:16763485-16763507 CTTGGAAAACATAAGTATTTAGG - Intergenic
1135073344 16:19371505-19371527 CAGGGTAAAAATCAGGATTCAGG + Intergenic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1143191054 17:5040549-5040571 CAGGGAGAAGCTAAGGTTTGAGG - Intronic
1144460773 17:15457102-15457124 CTGGGTAAAAATGAGGATTGAGG + Intronic
1145911459 17:28545879-28545901 TAGGGAAAAAAAAAGGACTGGGG - Intronic
1152247725 17:79194035-79194057 CAGGGAGAACATCAGGGTTTCGG - Intronic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1155305609 18:24475112-24475134 CAGGATTGACATAAGGATTGTGG + Intronic
1155612707 18:27684762-27684784 CAGCCAAAACAGTAGGATTGGGG + Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1158008417 18:52699815-52699837 CAAGGAAAACAAAAGAATTGGGG - Intronic
1158264988 18:55651940-55651962 CAGTGAAATCGTTAGGATTGTGG - Intronic
1159425017 18:68273681-68273703 CAAAGAAAACATGAGGATTATGG + Intergenic
1159858123 18:73613823-73613845 CAGGGAATATATAATGAATGAGG - Intergenic
1164569191 19:29357282-29357304 CATAGAACACATAAGGATTATGG + Intergenic
927012278 2:18916652-18916674 CACTGAAAACACCAGGATTGAGG - Intergenic
928138620 2:28708208-28708230 CAGGGAAGACAGAAAGAATGAGG + Intergenic
929239333 2:39637516-39637538 AATGGAGAACATAAAGATTGAGG - Intergenic
929449427 2:42026971-42026993 TAGAGAAACCATAAGGTTTGGGG - Intergenic
930409990 2:51013265-51013287 CAGGGCAAACATAAGCATGTGGG + Intronic
933352548 2:81173232-81173254 CAGGGAGAAGATAATGATTGAGG + Intergenic
933840971 2:86285250-86285272 CAGGAAAAACAAAAGAGTTGTGG - Intronic
933857137 2:86426787-86426809 CAGGGAATACAAAAAGATTAGGG + Intergenic
935255999 2:101310105-101310127 CATGGAAAACTTACGGGTTGTGG - Intergenic
936653173 2:114453618-114453640 CAGGAGTAACATGAGGATTGTGG + Intronic
936748589 2:115612435-115612457 CATGCAAAAAATAAGGCTTGAGG - Intronic
940029489 2:149246397-149246419 TAGGAAAAACATAATGAATGTGG + Intergenic
941082440 2:161077697-161077719 CAGGGAAAACAGCTGGGTTGGGG + Intergenic
941606458 2:167603427-167603449 CAGGGAAAACATTAGTATCCTGG + Intergenic
942572956 2:177331769-177331791 CAGGGAAAACATAAGAAAACTGG - Intronic
942810812 2:179998369-179998391 CAGGGTAATTATGAGGATTGAGG - Intronic
944299274 2:198104194-198104216 CAGGGACTACATGAGGATGGAGG - Intronic
945834522 2:214822861-214822883 CAGGGAAAATCCCAGGATTGGGG + Intergenic
947041977 2:225932786-225932808 CAGGGCAAACTCAAGCATTGGGG - Intergenic
947136736 2:226983451-226983473 CTGGGAAAAGAAATGGATTGAGG - Intronic
1168894863 20:1317269-1317291 TATGGAAAACATAAGCATTGAGG + Intronic
1168901351 20:1367744-1367766 CAGGGAAATCCTCTGGATTGGGG - Intronic
1172831987 20:37843706-37843728 GAGGGAAAACATGAAGCTTGAGG + Intronic
1172832062 20:37844367-37844389 GAGGGAAAACATGAAGCTTGAGG - Intronic
1172961618 20:38804581-38804603 CAGTGAAAAAAAAAGGATTCGGG + Intergenic
1174216277 20:48919058-48919080 CATTCAACACATAAGGATTGAGG + Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1175563168 20:59950348-59950370 AAGTGAAAACATAAAGATTTGGG + Intergenic
1177534528 21:22406784-22406806 TAGAGGAAACATAAAGATTGAGG + Intergenic
1177546050 21:22560818-22560840 GAGGGAAATAATAAGGCTTGGGG - Intergenic
1178045382 21:28687788-28687810 CAGGAAAAGCTTAAGGATGGAGG + Intergenic
1182171863 22:28238751-28238773 CAGGCAAAAAATAATTATTGAGG - Intronic
1183838937 22:40481482-40481504 CAGGGAAAACATAATAAATAAGG + Intronic
1184496426 22:44845022-44845044 CAGGGAAGACATGGGGTTTGGGG - Intronic
1184578340 22:45393286-45393308 CATGAAAAACATGAGGTTTGAGG + Intronic
949438832 3:4058396-4058418 CAGGGACATGATAAGGAATGAGG + Intronic
949724352 3:7026083-7026105 CAGGGAAAAGAAGTGGATTGTGG + Intronic
950883733 3:16344991-16345013 CATGGAAAGCATAAGAAATGGGG + Intronic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
956656313 3:71556044-71556066 GAAGGAAAACATAAAAATTGGGG + Intronic
957432311 3:80126517-80126539 CAAGGAAATAATAAGGCTTGAGG + Intergenic
957922178 3:86760075-86760097 CAGGGAAAGCTTATGGCTTGGGG - Intergenic
958260602 3:91376202-91376224 CAAGGAAACAATAAGGAATGAGG + Intergenic
958812979 3:98883375-98883397 TAGGGAAAAAATAAGGTGTGCGG - Intronic
960735665 3:120777043-120777065 AAGAGAAAACATAAAGTTTGGGG - Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
966059803 3:175741061-175741083 TAGGGGAAGCACAAGGATTGAGG + Intronic
966264980 3:178029108-178029130 CAGGAAAGACATAAGTGTTGGGG - Intergenic
966316869 3:178657166-178657188 CAGGGAAAACATATGGGTTCTGG - Intronic
966818431 3:183907374-183907396 CAGGGAATAAAAAAGGTTTGGGG + Intergenic
967591268 3:191276413-191276435 CTGGGAAAACATAACATTTGGGG + Intronic
968416420 4:438911-438933 CTGGGAAGACATAAGTATTGGGG - Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973068175 4:45823165-45823187 AAGTGAAAACATAAGGTTTTTGG - Intergenic
974811223 4:66948684-66948706 CAGAGAAATCATAAGAAGTGAGG - Intergenic
974902899 4:68022683-68022705 GAGGGAAAACTTCAGGATAGTGG - Intergenic
975521431 4:75305769-75305791 TAAGGAAAAAAAAAGGATTGTGG - Intergenic
977439691 4:97048123-97048145 TGGTGAAAAAATAAGGATTGTGG + Intergenic
977507481 4:97920765-97920787 CAGTTAACACATAAGGACTGTGG + Intronic
978815193 4:112896482-112896504 AAGGGAGAAAAAAAGGATTGAGG + Intronic
979806146 4:124973656-124973678 CAGGGGAAGCATAGGGAATGAGG + Intergenic
979945724 4:126829534-126829556 CAGGGAAAGCACAGTGATTGCGG + Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980786438 4:137562157-137562179 CAGGGAATAAATAAGGAATAAGG - Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
982104008 4:151996157-151996179 CAAGGAAAATCTAAAGATTGGGG - Intergenic
982342924 4:154323182-154323204 TAAGGAAAACATAAGAATAGAGG - Intronic
982420300 4:155187863-155187885 CATGGAAAAGATAAAGGTTGTGG - Intergenic
983034201 4:162842414-162842436 CAAAGAAAACATAAGGGGTGAGG - Intergenic
983389589 4:167112508-167112530 GCAGGAAAACATAGGGATTGAGG + Intronic
985050310 4:185984176-185984198 CAGAGAAACAATAAGAATTGTGG - Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
987183270 5:15388009-15388031 CAGGAAGAAAATAAGGAATGTGG + Intergenic
987207392 5:15641443-15641465 CAGGGAAACCAAGAGGAATGGGG + Intronic
989781476 5:45270095-45270117 CAAGGAAAACAAAAGTATTATGG - Intronic
989981251 5:50648392-50648414 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
990778528 5:59331569-59331591 TAGGGAAAACATGAGGCTTATGG - Intronic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
993074085 5:83205182-83205204 CAGGAAAAGCATAAGCAATGAGG + Intronic
995245154 5:109927119-109927141 CAGTGAAAGCACAATGATTGGGG + Intergenic
995294539 5:110504255-110504277 CAGGAAAAACATAAATATAGAGG + Intronic
996781347 5:127190105-127190127 GAGGGAAAACATTAAGAATGTGG + Intergenic
998658866 5:144213551-144213573 TACCAAAAACATAAGGATTGAGG - Intronic
999880964 5:155863517-155863539 CAGGGAAAGCAAAAGCATTTGGG - Intergenic
999934964 5:156476434-156476456 CAGGTAAAAAATAAAGATTATGG - Intronic
999956295 5:156706369-156706391 CAGGGGAAATACAAGCATTGTGG - Intronic
1000973857 5:167743304-167743326 GAGGGAAAACATGGGGACTGAGG + Intronic
1001041910 5:168342243-168342265 GAGGGAAAACATAAAGATCAGGG + Intronic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1001914471 5:175548036-175548058 AAGGGAGAACAAAAGGATTGGGG - Intergenic
1003121325 6:3321145-3321167 CACGGAAAACATATGCATGGAGG - Intronic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1007274197 6:40661446-40661468 CAGGGAAAAAATAAGGTTCGAGG + Intergenic
1008407961 6:51140334-51140356 AAGGGAAAGCAAAATGATTGAGG - Intergenic
1008481485 6:51990385-51990407 CAAGGAAAGCAAAAGGACTGGGG - Intronic
1008994614 6:57644178-57644200 CAAGGAAACAATAAGGAATGAGG - Intronic
1009183157 6:60543001-60543023 CAAGGAAACAATAAGGAATGAGG - Intergenic
1009757954 6:67964479-67964501 CCGTGAACACATAAGGAATGTGG - Intergenic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010396877 6:75403140-75403162 CAGGAGAAAGATAAGCATTGGGG + Intronic
1011614196 6:89183098-89183120 CAAGGAAAACATATGCATGGAGG + Intronic
1012731197 6:102884567-102884589 GAAGGAAAACATAATTATTGTGG + Intergenic
1013159797 6:107531983-107532005 CAGGGAAAAGATTTGGTTTGAGG - Intronic
1014840903 6:126219008-126219030 GAGGGAAAGCATAACAATTGTGG - Intergenic
1015763856 6:136694570-136694592 CAGGGAAATTGGAAGGATTGTGG - Intronic
1016517437 6:144910516-144910538 CAGGGAAAAAAATATGATTGGGG + Intergenic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1020656970 7:10939981-10940003 AAGGGAAAACATTAGGAGAGCGG + Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021475883 7:21060070-21060092 CAGGGAAAAGATTAGGATATGGG + Intergenic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1025961525 7:66226548-66226570 AAGGGAAAACAAAGGGATTTTGG - Intronic
1027569692 7:79848399-79848421 TAAGGAAAACATCAGGACTGGGG - Intergenic
1028439332 7:90840752-90840774 AAGGTAAAACATACTGATTGTGG - Intronic
1028706538 7:93855056-93855078 AAGGGAAAACATCAGAAGTGGGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029497543 7:100904476-100904498 CAGGCAAAAAATAAAGAATGAGG - Intergenic
1030255644 7:107506694-107506716 CAGGGAAGGCATATGGCTTGGGG - Intronic
1031348911 7:120703954-120703976 CAGGGAAACCATCAGAAATGTGG - Intronic
1032794777 7:135268813-135268835 GAGGGAACACATCAGGAGTGCGG - Intergenic
1033148055 7:138888115-138888137 CACGGAAAGCATATGCATTGTGG - Intronic
1033348734 7:140544899-140544921 AAAGCAAAACAAAAGGATTGGGG + Intronic
1033915455 7:146319103-146319125 CATGGAGAACAAAAAGATTGAGG - Intronic
1034599218 7:152232593-152232615 CAGGGAAATAAGAAGGACTGAGG + Intronic
1035495506 7:159322077-159322099 AAAGGAAAACAACAGGATTGTGG + Intergenic
1039835199 8:41250290-41250312 CAAGAAAAACAGAAAGATTGAGG + Intergenic
1040500802 8:48003350-48003372 CAGGGAAAACATAATGAAAGTGG + Intergenic
1041344371 8:56881149-56881171 CATAGAATACATTAGGATTGAGG - Intergenic
1042802672 8:72737590-72737612 CATGGAAGACATCATGATTGAGG + Intronic
1043184499 8:77129378-77129400 CAGGGACAGCTTAAGGAATGGGG - Intergenic
1044469451 8:92549794-92549816 CAGGGAAAACCCGAGGAGTGCGG - Intergenic
1046057175 8:109092916-109092938 CAGTGAAAACATAAGAAAAGCGG - Intronic
1046793471 8:118346067-118346089 CAGGGAAATCATAATTATCGAGG + Intronic
1046875030 8:119245120-119245142 GAGGAAAAACAAAAGGTTTGAGG + Exonic
1048512759 8:135077671-135077693 CTGGGAAGACATAAGCAGTGTGG + Intergenic
1048736855 8:137511776-137511798 TATGGAAAACATTAGGATTTTGG - Intergenic
1050985865 9:12081205-12081227 CAGAGCACACTTAAGGATTGTGG - Intergenic
1053189824 9:36054262-36054284 TAGGGAAAAGATATGGTTTGAGG + Intronic
1053289038 9:36868023-36868045 AAGGGAAAACATGAGGGATGAGG + Intronic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1056247404 9:84709647-84709669 CACGGAAATCTTAAGTATTGTGG + Intronic
1058638027 9:107055936-107055958 CAGGGAAGGAATAAGGATTCTGG + Intergenic
1059218356 9:112588777-112588799 CAGGGAAAACCTCAGGGTTGGGG - Intronic
1059259329 9:112960616-112960638 CAGGGAAAAAATATAAATTGGGG - Intergenic
1059481963 9:114598379-114598401 CAGGGAAAAAAAAAAGAATGGGG - Intergenic
1188067963 X:25684746-25684768 CAGGGAAAAAAAAAAGATTTAGG - Intergenic
1188193789 X:27205653-27205675 CAGCAAAAACTGAAGGATTGAGG + Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188554363 X:31395386-31395408 CAGGGAAAACAAAGGGGATGGGG - Intronic
1188675470 X:32934586-32934608 AAGGGAAATCATAAAAATTGGGG - Intronic
1190289229 X:48981325-48981347 CAGGGGTAACATGAGGACTGAGG + Intronic
1190397629 X:50000819-50000841 CAGGCAAAGCATATGGATTAAGG - Intronic
1191594514 X:62927819-62927841 CAGGAATAAAATAAGGAATGTGG - Intergenic
1192488045 X:71547819-71547841 AAGGGAAAAAAAAAAGATTGGGG - Intronic
1193290134 X:79762756-79762778 CAAGCAAAATATAAGGGTTGAGG - Intergenic
1195028273 X:100900359-100900381 TAGTGAAAAAATAAGGACTGGGG - Intergenic
1195152073 X:102082252-102082274 CAGGGACAAGATAGGGAGTGGGG - Intergenic
1195227726 X:102815519-102815541 GAGGGACAAAATAAGGAGTGGGG + Intergenic
1195252468 X:103062879-103062901 TAGGGAAACCATCAGGATTCAGG + Exonic
1195278668 X:103309572-103309594 CAGGGAAACCATCAGGATTCAGG + Exonic
1195976716 X:110535036-110535058 CAAGGAAAACACAAGATTTGGGG + Intergenic
1196444498 X:115738482-115738504 CAGGGAAAACATTGGAATTTGGG - Intergenic
1197439219 X:126470280-126470302 GAGGGAAAGCATAGTGATTGTGG + Intergenic
1197458667 X:126710530-126710552 CAGTGAAAACATAAGAATTAGGG + Intergenic
1198066100 X:133098002-133098024 ATGGGAAAACATTAGAATTGGGG + Intergenic
1198647246 X:138822809-138822831 CAGTAAAAGCATAATGATTGTGG - Intronic
1198738195 X:139810762-139810784 GTGTGAAAACATATGGATTGGGG - Intronic
1199372370 X:147065420-147065442 CAAGGAAATAATAAAGATTGCGG - Intergenic
1199525070 X:148783100-148783122 AAAGGAAGACATAAAGATTGAGG - Intronic