ID: 1100677524

View in Genome Browser
Species Human (GRCh38)
Location 12:96884256-96884278
Sequence CTGAGATTGCCCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100677524_1100677528 -8 Left 1100677524 12:96884256-96884278 CCCTCTTCCCTGGGCAATCTCAG No data
Right 1100677528 12:96884271-96884293 AATCTCAGTCTTTTCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100677524 Original CRISPR CTGAGATTGCCCAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr