ID: 1100677528

View in Genome Browser
Species Human (GRCh38)
Location 12:96884271-96884293
Sequence AATCTCAGTCTTTTCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100677524_1100677528 -8 Left 1100677524 12:96884256-96884278 CCCTCTTCCCTGGGCAATCTCAG No data
Right 1100677528 12:96884271-96884293 AATCTCAGTCTTTTCTTTGATGG No data
1100677520_1100677528 18 Left 1100677520 12:96884230-96884252 CCCAAAGGCAATCTGGAGGCAGA No data
Right 1100677528 12:96884271-96884293 AATCTCAGTCTTTTCTTTGATGG No data
1100677525_1100677528 -9 Left 1100677525 12:96884257-96884279 CCTCTTCCCTGGGCAATCTCAGT No data
Right 1100677528 12:96884271-96884293 AATCTCAGTCTTTTCTTTGATGG No data
1100677521_1100677528 17 Left 1100677521 12:96884231-96884253 CCAAAGGCAATCTGGAGGCAGAA No data
Right 1100677528 12:96884271-96884293 AATCTCAGTCTTTTCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100677528 Original CRISPR AATCTCAGTCTTTTCTTTGA TGG Intergenic
No off target data available for this crispr