ID: 1100679776

View in Genome Browser
Species Human (GRCh38)
Location 12:96907055-96907077
Sequence GCGGGAACTGCGGGCCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100679776_1100679788 5 Left 1100679776 12:96907055-96907077 CCGCCCCGGCCCGCAGTTCCCGC 0: 1
1: 0
2: 1
3: 35
4: 404
Right 1100679788 12:96907083-96907105 CACTGGGATAACTTCCCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100679776 Original CRISPR GCGGGAACTGCGGGCCGGGG CGG (reversed) Intergenic