ID: 1100679776

View in Genome Browser
Species Human (GRCh38)
Location 12:96907055-96907077
Sequence GCGGGAACTGCGGGCCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100679776_1100679788 5 Left 1100679776 12:96907055-96907077 CCGCCCCGGCCCGCAGTTCCCGC 0: 1
1: 0
2: 1
3: 35
4: 404
Right 1100679788 12:96907083-96907105 CACTGGGATAACTTCCCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100679776 Original CRISPR GCGGGAACTGCGGGCCGGGG CGG (reversed) Intergenic
900191799 1:1355211-1355233 GCGGGAGCTGGGGGGCGGGGGGG + Intronic
900227484 1:1540009-1540031 GAGGGGACCGCGGGCCGGGGAGG + Intronic
900227494 1:1540030-1540052 GGGGGAAGCGCAGGCCGGGGTGG + Intronic
900481998 1:2904021-2904043 GCGGGAATTCCGGGACGGTGGGG - Intergenic
900682448 1:3924455-3924477 GGCGGACCTGCGGGCCGAGGTGG + Intergenic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
901021942 1:6260379-6260401 GCGGGGATTGCGGGGGGGGGGGG - Intronic
901050716 1:6424699-6424721 GCGGAGGCTGCGGGGCGGGGCGG + Intergenic
901088237 1:6625134-6625156 GAGGGACCTGCGGGGAGGGGCGG - Exonic
901540194 1:9910398-9910420 GCGGGGCCTGCGGGCGGGGCGGG + Intergenic
901704020 1:11060059-11060081 GCGGGGCCTGCCGGCGGGGGCGG + Intergenic
902896993 1:19485715-19485737 GCGGGGCCTGCGAGGCGGGGCGG + Intergenic
903023398 1:20410275-20410297 GCTGGAACTGTGGACCAGGGAGG - Intergenic
903780445 1:25817036-25817058 GAGAGAACTGGGGGCTGGGGAGG - Exonic
905105440 1:35560925-35560947 CCGGGATCTGCAGGCCGGGCTGG + Exonic
905183190 1:36178854-36178876 GCGGGCGCCGCGGGCCGGGAGGG + Intronic
905639128 1:39576521-39576543 GAGGGCACGGCGGGCCGGGCGGG + Intronic
905849664 1:41264229-41264251 GCAGAAACTGAGGGCCGAGGTGG - Intergenic
905919848 1:41712072-41712094 GGGGAAACTGAGGTCCGGGGAGG + Intronic
906109282 1:43312470-43312492 GAGGGCAGTGCGGGCCTGGGGGG - Exonic
907012678 1:50978064-50978086 GCGGGAGCGGGGGGGCGGGGAGG + Intergenic
907682622 1:56578710-56578732 GCGGGGGCTTCGGGCCTGGGCGG + Intronic
910597207 1:88992817-88992839 GCGGGAACAAGGGGGCGGGGCGG + Exonic
910990916 1:93054910-93054932 GCGGAAACTGGGGGTGGGGGGGG - Intergenic
913958840 1:143324062-143324084 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
914053157 1:144149442-144149464 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
914126040 1:144817099-144817121 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
917535703 1:175872913-175872935 TCGGCAACTGCAGGACGGGGAGG + Intergenic
920333340 1:205228010-205228032 GCGGGGCGCGCGGGCCGGGGAGG + Intergenic
920702894 1:208231205-208231227 GTGGGAATGGCAGGCCGGGGAGG + Intronic
921234959 1:213117083-213117105 GCAGAAACTGGGGGCTGGGGAGG - Intronic
923035196 1:230280694-230280716 GAGGGAGCTGCGGGCGGGGCAGG - Exonic
924946069 1:248847760-248847782 GCGGGCACTGCGCGCAGCGGTGG - Exonic
1062889646 10:1048793-1048815 CGGGGAGCTGCGGGACGGGGCGG - Intronic
1064009590 10:11725023-11725045 CCGTGAACGGCGGGGCGGGGGGG + Intergenic
1065110453 10:22435875-22435897 GCGAGAGGTGCAGGCCGGGGTGG + Intronic
1066758848 10:38736557-38736579 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1066986907 10:42475988-42476010 GCGGGGGTTGCGCGCCGGGGAGG + Intergenic
1068788359 10:61001493-61001515 GCGGGGTCGGCGGGGCGGGGCGG - Intergenic
1069557640 10:69408248-69408270 GCTGGAACTGCGGACCCCGGAGG - Intronic
1071049300 10:81427448-81427470 GGGGGAACTGGGGGTGGGGGTGG - Intergenic
1073287306 10:102396661-102396683 GCGGTCACTGCTGGCCTGGGTGG + Intronic
1074761531 10:116670301-116670323 GCGGGAACAGGGGGCGGGGCCGG + Intergenic
1074816006 10:117140891-117140913 GGGGGAGCTGGGGGGCGGGGCGG + Intergenic
1074873430 10:117595665-117595687 GCAGGAGCTGCAGGCCTGGGAGG + Intergenic
1075048639 10:119165723-119165745 GCGGGAACTGCGGGTGCGCGCGG - Intergenic
1075263105 10:120979834-120979856 GCAGGAACGGCCGGGCGGGGCGG - Intergenic
1075827453 10:125371251-125371273 GCGGGAATTGCGGGGATGGGAGG - Intergenic
1076373377 10:129968484-129968506 CCGGGAACTGCGGGATAGGGTGG + Intergenic
1076757309 10:132579242-132579264 GAGGGGACCGCGGGGCGGGGTGG + Intronic
1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG + Intergenic
1076905270 10:133358040-133358062 GCGGGGCTTGGGGGCCGGGGCGG + Intergenic
1076911983 10:133394890-133394912 GCGTGTACTGGGGGCCGAGGGGG + Intronic
1077105926 11:842653-842675 GCGGAAACTGCGGCCAGCGGTGG - Intergenic
1077322082 11:1947108-1947130 GCGGGGAGTGGGGGTCGGGGCGG + Intergenic
1077370323 11:2178859-2178881 GCAGGAACTCAGGGCCGGTGGGG - Intergenic
1077423354 11:2463097-2463119 GTGGGAAGTGGGGGACGGGGTGG + Intronic
1077476208 11:2791686-2791708 GCGGCAGCTGCGGGTGGGGGTGG + Intronic
1078190665 11:9091034-9091056 GGGGAAACTGAGGGCCGGGCCGG - Intronic
1079413694 11:20213044-20213066 GCGTGAGCTGCGTGCAGGGGCGG + Intergenic
1081831603 11:46120387-46120409 CCGGGGGCTGCGGGCGGGGGCGG - Intronic
1083272987 11:61581289-61581311 GCGGGGACTGCGAGGCGGGCGGG - Intergenic
1083295208 11:61711565-61711587 GCGGGAAGTGAGGGCCAGGAGGG - Intronic
1083878075 11:65535187-65535209 GTGGGAACTGTGGGCTGTGGCGG - Intronic
1083893387 11:65608033-65608055 GTGGGAACTGCTGACCGGGGAGG - Exonic
1083904286 11:65660060-65660082 GCAGGAAAGGCGGGCTGGGGAGG + Intronic
1084041760 11:66546742-66546764 CCGGGAACTGCGGGACTCGGGGG - Exonic
1084272457 11:68036596-68036618 GCAGGGGCTGCGGGCCGGTGGGG - Exonic
1084394505 11:68899973-68899995 GCCGGAACTGCACCCCGGGGGGG + Intronic
1084473450 11:69376076-69376098 GCAGGAACTGCAGGCAGGCGTGG - Intergenic
1085284632 11:75351740-75351762 GCGGGGACCGGGGGCGGGGGCGG - Intergenic
1086064723 11:82733122-82733144 GCGGGCACTGGGGGCGCGGGAGG - Exonic
1088742912 11:112781330-112781352 GGGTGAACTGCGGGCAGGGTGGG + Intergenic
1088869009 11:113875604-113875626 GCGCGCGCTGCGGGCGGGGGCGG - Intergenic
1089202063 11:116730447-116730469 GCGAGAGCGGTGGGCCGGGGAGG - Intergenic
1202805098 11_KI270721v1_random:2421-2443 GCGGGGAGTGGGGGTCGGGGCGG + Intergenic
1091473709 12:752786-752808 GAGGGAACGGCGGGGAGGGGAGG - Intronic
1093077691 12:14774530-14774552 CCGGGAACTGCAGGCCCGCGCGG - Exonic
1096666884 12:53171915-53171937 GAGGAAACTGCGGGCCCTGGTGG - Exonic
1100611506 12:96194820-96194842 GGGTGGGCTGCGGGCCGGGGTGG + Intronic
1100632312 12:96400634-96400656 GCGGGGCCTGCAGGGCGGGGCGG + Intergenic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1101910562 12:108857648-108857670 GCGGGAGCTGGGGGCGGGGGCGG - Intergenic
1102196989 12:111033342-111033364 GCGGAAACTGTGGGCGGTGGTGG + Intergenic
1102734477 12:115146118-115146140 GAGGGATCTGGGGGCAGGGGTGG - Intergenic
1102961942 12:117098959-117098981 CGGGGGACTGCGGACCGGGGAGG - Intronic
1104049630 12:125186728-125186750 CCGGGAGCCGCGGGCCGGGCCGG + Intergenic
1104608458 12:130206953-130206975 GAGGGAACTGAGGCCCAGGGAGG + Intergenic
1104854198 12:131894571-131894593 GCGGGGCCTGCGGGACGGAGCGG - Intergenic
1105019968 12:132809437-132809459 CCGGGAACCGGGGGGCGGGGGGG - Intronic
1107276579 13:38686897-38686919 GGGGAAACTGCGGGGAGGGGAGG - Intergenic
1108029221 13:46211765-46211787 GGGGAAGCTGCGGGCCGTGGGGG - Intronic
1108063257 13:46553358-46553380 GCAGGAGCGGCGGGGCGGGGTGG + Exonic
1108446357 13:50512654-50512676 GGGGGACCTGCAGGCTGGGGAGG + Intronic
1108688993 13:52846054-52846076 CCGGGAAGAGCGGCCCGGGGCGG - Exonic
1112507780 13:99985354-99985376 GCCGGAGCTGGCGGCCGGGGAGG - Exonic
1113785913 13:113002040-113002062 GCGGGGACGCCGGGCGGGGGTGG + Intronic
1113786276 13:113003572-113003594 GAGGGAACTGCAGGATGGGGTGG - Intronic
1114259137 14:21025077-21025099 GCGGGAAGCCCGAGCCGGGGCGG - Intronic
1114292598 14:21301002-21301024 CCGGGACCTGCGGGTCGCGGAGG + Exonic
1114485155 14:23057637-23057659 GCGGGCCCGGCTGGCCGGGGAGG - Intergenic
1114637340 14:24195349-24195371 GCGGGAAGGGCTGGCCGAGGCGG + Intronic
1115120110 14:29928007-29928029 CCGGGAACTGCGGGCGGAGGGGG - Intronic
1115576290 14:34714821-34714843 GCGAGCCCTGCAGGCCGGGGGGG + Intronic
1118607722 14:67515535-67515557 GAGGGGACAGCGGGCCGGGCCGG - Intronic
1119240832 14:73058499-73058521 GCGTGCACTGCGGCCGGGGGCGG - Exonic
1120789082 14:88562976-88562998 GCGCGCAGTGCCGGCCGGGGCGG + Exonic
1120789152 14:88563234-88563256 ACGGGGACTGTGGGCCCGGGTGG + Intronic
1121473341 14:94173960-94173982 GCGGGGGCTGGGGGGCGGGGAGG - Intronic
1122402526 14:101475699-101475721 GCGGCATGTGCGGGCCTGGGGGG - Intergenic
1122603545 14:102932886-102932908 GCGGGCAGGGCGGGGCGGGGTGG + Exonic
1122788089 14:104173146-104173168 GCGGGACCTGCTGGCCGAGGTGG + Exonic
1122926710 14:104906517-104906539 GTGGGAACCGCGAGCCGGGACGG + Intergenic
1122926772 14:104906780-104906802 GTGGGAACCGCGAGCCGGGACGG + Intergenic
1123422729 15:20145095-20145117 CCGGGAACTGAGGTCTGGGGTGG + Intergenic
1123531955 15:21151635-21151657 CCGGGAACTGAGGTCTGGGGTGG + Intergenic
1123630741 15:22258202-22258224 GCGGGCGCCGCGGGCCGGGCGGG - Intergenic
1124602822 15:31149136-31149158 AAGGGAACTGAGGGCTGGGGAGG + Intronic
1124999327 15:34754553-34754575 TCTGGAAGTGCGGCCCGGGGAGG - Exonic
1125606318 15:40941777-40941799 GCGGGAGCTGCGGGGCACGGCGG - Intergenic
1127606258 15:60591627-60591649 ACGGGATCCGCGGGCAGGGGCGG - Intronic
1128498418 15:68210994-68211016 GCGGGCACTGAGGGCTGGGCGGG + Intronic
1129273861 15:74433198-74433220 GCCCGAGCTCCGGGCCGGGGCGG + Intronic
1129468784 15:75738767-75738789 GCGCGGGCTGCGGGGCGGGGTGG - Intergenic
1129739355 15:77982594-77982616 GGGGGTACTGGGGGGCGGGGGGG - Intergenic
1131054558 15:89367849-89367871 GCGGGGGCTGCGGGCCTAGGTGG + Intergenic
1131191477 15:90320239-90320261 GCGGTAACTGCTGGCCAGAGAGG + Intergenic
1132011780 15:98282448-98282470 GCTGGGACTGCGGTCTGGGGTGG + Intergenic
1132805071 16:1771550-1771572 GCGGGATCCGCGGGGCGGGGCGG + Exonic
1132891493 16:2207019-2207041 CCGGGACCTGCGGGCCGGGCCGG - Exonic
1133021584 16:2969277-2969299 GCGGGAACTAGGAGCCTGGGCGG + Exonic
1133024763 16:2983763-2983785 GCGGGAACCGGGTGCCTGGGCGG - Intergenic
1133144107 16:3770793-3770815 GTGGGAGCTGCTGGCTGGGGAGG + Exonic
1133188518 16:4116574-4116596 GCTGGGGCTGCGGGGCGGGGCGG + Intergenic
1133287780 16:4698533-4698555 GCAGGAGCTGCGCGCCGTGGTGG - Exonic
1133332960 16:4987772-4987794 GCGGGAGCTGGGGACCAGGGCGG + Intronic
1133440019 16:5813400-5813422 GTGGTTACTGAGGGCCGGGGAGG - Intergenic
1133771506 16:8869195-8869217 GCGGGACGTAGGGGCCGGGGCGG + Intergenic
1134134049 16:11668342-11668364 GCTGGGACGGCGGGGCGGGGCGG - Intergenic
1134134182 16:11668652-11668674 CCGGGGTCTGCGGGCGGGGGAGG + Intronic
1135382759 16:22008206-22008228 GCGGGGACTCCGGGCCCCGGCGG + Exonic
1135607354 16:23836101-23836123 CCGCGGGCTGCGGGCCGGGGAGG - Exonic
1136285319 16:29237209-29237231 GCGGGAACGGCGGGGAGGCGAGG + Intergenic
1136285328 16:29237234-29237256 GCGGGAACGGCGGGGAGGCGAGG + Intergenic
1136285337 16:29237259-29237281 GCGGGAACGGCGGGGAGGTGAGG + Intergenic
1136285346 16:29237284-29237306 GCGGGAACGGCGGGGAGGTGAGG + Intergenic
1136540306 16:30924662-30924684 GCGGCGACTGCAGGCGGGGGTGG - Exonic
1136555461 16:31005117-31005139 GAGGGAACTGGGGCCCAGGGAGG - Intronic
1136556506 16:31010514-31010536 GGGGGGCCTGCGGGCGGGGGCGG + Exonic
1136772977 16:32857662-32857684 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1136842289 16:33548696-33548718 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1138279234 16:55760543-55760565 GCGGTAACTGGGGGCCAGGGTGG + Intergenic
1138327927 16:56191191-56191213 GGGGGAGCCGCGGGCCGGGAGGG + Intergenic
1138516269 16:57536739-57536761 GCGAGGGGTGCGGGCCGGGGCGG + Intergenic
1139364513 16:66425686-66425708 GCGGGGAGTGGGGGCGGGGGGGG + Intergenic
1139489533 16:67279115-67279137 GGGGGCACCGCGGGACGGGGCGG - Exonic
1139544706 16:67644871-67644893 GCAGGGACTGCGGGGCGGGGTGG + Intergenic
1139679914 16:68553451-68553473 GCGAGAGCTGCAGGCAGGGGAGG + Intronic
1139754563 16:69132316-69132338 GCGGGGAGCGCGGGCGGGGGAGG - Intronic
1141972304 16:87492371-87492393 GCGGGCGCCGCGGGCCGGGCGGG + Intergenic
1142131064 16:88431690-88431712 GCAGGAGCTGCTGGCCGGCGGGG - Exonic
1142173496 16:88634671-88634693 GCGGGACCTGCGGACTGGGCGGG - Intergenic
1142262046 16:89047630-89047652 GCGGGAATGGCAGGCGGGGGAGG + Intergenic
1142312393 16:89321463-89321485 GCGGGGACTGTGGGGCCGGGTGG + Intronic
1142412366 16:89923219-89923241 GCGGAGCCTGCGGGCCGGGCGGG + Intronic
1142434342 16:90047390-90047412 GCTGGAACTGAGGGCCTGGGGGG - Intergenic
1203075402 16_KI270728v1_random:1119772-1119794 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1203152454 16_KI270728v1_random:1848993-1849015 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1142611055 17:1109370-1109392 GCGGGCCCTGCGGGGCCGGGCGG - Intronic
1142876157 17:2853236-2853258 CCGGGAGCTGCGAGCCGGGGCGG + Intronic
1143099752 17:4498735-4498757 CCGGGGACTGGGGGCCCGGGCGG - Intergenic
1143270799 17:5673216-5673238 CTGGGACCTGTGGGCCGGGGTGG - Intergenic
1143635758 17:8162998-8163020 CCGGGCACTGCGGGCGGGGGCGG + Intronic
1144784379 17:17823693-17823715 GCGGGACCTGCAGGCGGGGCGGG - Intronic
1145273356 17:21416268-21416290 GTAGGAGCTGCGGGCCTGGGTGG - Exonic
1145311545 17:21703712-21703734 GTAGGAGCTGCGGGCCTGGGTGG - Exonic
1146283337 17:31559152-31559174 GGGCGAAGGGCGGGCCGGGGCGG + Intergenic
1146377100 17:32302214-32302236 GCAGGAAGTGTGGGCCAGGGAGG - Intronic
1147132844 17:38419219-38419241 GCGGGGCCGGCGGGGCGGGGCGG + Intergenic
1147183637 17:38702298-38702320 CCGGGAGGTGCGGGCCGGCGCGG + Intergenic
1147257707 17:39191937-39191959 GCGGGTGCTGGGGGCAGGGGAGG - Intronic
1147262480 17:39216780-39216802 GCAGGGACTGCGGCCAGGGGGGG + Intronic
1148017944 17:44535736-44535758 GTGGGGACTGAGGGCGGGGGAGG + Intergenic
1150373666 17:64662375-64662397 GCGGGGCCGGCGGGGCGGGGCGG + Intergenic
1150643553 17:66964862-66964884 GCGGGCGCGGCGGGCCGGGCCGG + Intergenic
1151745360 17:76008956-76008978 GCAGCAGCTGCGGGCCGGCGTGG - Exonic
1152093352 17:78258744-78258766 GCAGGAAGTGCGCGCCGGGGAGG + Intergenic
1152102331 17:78309356-78309378 GAGAGAACTGAGGGCCAGGGAGG + Intergenic
1152605642 17:81288306-81288328 GCGGGAGCTGTGAGCCCGGGGGG + Intronic
1152711173 17:81871118-81871140 GCGGTGACAGCGGGCCAGGGCGG - Intronic
1152733727 17:81986638-81986660 GAGGAAACTGAGGCCCGGGGAGG - Intronic
1152762958 17:82119083-82119105 GCGGGAGGTGGGGGCGGGGGTGG + Intronic
1152863704 17:82710105-82710127 GCGGGAACAGCGGGGTGGTGAGG - Intergenic
1152963638 18:96301-96323 GCGGGGACTGCGGGGCCGTGTGG + Intergenic
1152971881 18:169925-169947 GAGGGAACTGCGGGTCGGTGAGG - Intronic
1154334515 18:13455082-13455104 GCAGGAGCTGGGGGCTGGGGAGG + Intronic
1154501339 18:14999337-14999359 CGTGGAACTGCGGGGCGGGGCGG + Intergenic
1156008578 18:32470970-32470992 GCGGGAGCTGCGGGAGGCGGAGG - Intergenic
1157417766 18:47520372-47520394 GTGGGCACTGCGGGGGGGGGGGG - Intergenic
1157462968 18:47918060-47918082 GCAGGAACTGAGGGCCAGGCAGG + Intronic
1158427313 18:57352056-57352078 GCGGGGGCAGGGGGCCGGGGCGG + Exonic
1159670153 18:71212532-71212554 GCGGGGGCGGCGGGGCGGGGCGG + Intergenic
1160166647 18:76518779-76518801 GCCGAAACTGCAGCCCGGGGTGG + Intergenic
1160499538 18:79395378-79395400 GCGGGGGCCGGGGGCCGGGGAGG - Intergenic
1160717370 19:582426-582448 GGGGGTCCTGGGGGCCGGGGTGG + Intronic
1160725808 19:617367-617389 GCTCGAACTGCGGGCCAGGGCGG - Intronic
1160820601 19:1056020-1056042 AGGGGAGCTGAGGGCCGGGGGGG - Intronic
1160866812 19:1259827-1259849 GTGGGGTCTGCGGGACGGGGTGG - Intronic
1160930656 19:1568172-1568194 GCGGGCACGGGGGGCCGGGCGGG + Intergenic
1161001350 19:1912662-1912684 GCGGGGCTTGCGGGCCGTGGGGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161222145 19:3122752-3122774 GCGGGAACTGCTGGTTGGAGTGG - Exonic
1161264863 19:3359512-3359534 GAGGGTCCTGCGGGCCGGGGGGG + Intergenic
1161299615 19:3536498-3536520 TTGGCAACTGCGGGCAGGGGCGG - Intronic
1161319225 19:3633335-3633357 GCAGGGACTGAGGCCCGGGGCGG - Intronic
1161428565 19:4217647-4217669 GCGGGGCCTGCGGGCCGAGCTGG + Exonic
1161443313 19:4304705-4304727 GCGGGGCCCGCGGGCCGGGCCGG + Exonic
1161484017 19:4525118-4525140 GGGGGAGCTGGGGGTCGGGGTGG + Intronic
1161504437 19:4636326-4636348 GCGGGATCTGCGTGCGGGGCGGG - Intergenic
1161959556 19:7516212-7516234 GCGGGCGCGGCGGGCCGGGCAGG + Exonic
1161973505 19:7596434-7596456 GCGGGGTCTGCGGGCCGGGTGGG + Intronic
1162448154 19:10737165-10737187 GAGGGAACTGAGGGCCAGGGAGG - Intronic
1162470814 19:10871318-10871340 CCGGGAACTGCGGGGCGGGAGGG - Intergenic
1162751789 19:12833935-12833957 GCGGCGACTTCGGCCCGGGGAGG - Intronic
1163503294 19:17688422-17688444 GGGGGCGCTGCGGGCTGGGGGGG + Intergenic
1163747467 19:19056887-19056909 TGGGGAACTGCTGGCCAGGGTGG - Intronic
1164831809 19:31328358-31328380 GCGGGGACTGCGGGCCACGTTGG + Intronic
1165157444 19:33796800-33796822 GCGTGAAGCGGGGGCCGGGGCGG + Intronic
1166084687 19:40467079-40467101 GCGGGGACCGCGGGCGGGAGGGG + Intronic
1167410005 19:49338974-49338996 GCGGGGCCTGCGGGAGGGGGAGG + Intronic
1168339314 19:55614473-55614495 GCGGGAGGTGGGGGCCGGGCTGG - Exonic
1202692553 1_KI270712v1_random:101865-101887 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
925984882 2:9207276-9207298 GCGGGAGCGGCGGGCGGGGCTGG - Intronic
926101850 2:10122911-10122933 GAGGGCGCTGCGGGCAGGGGAGG + Intronic
926250953 2:11155304-11155326 GCGGGAGGGGCGGGGCGGGGCGG + Intronic
926914377 2:17878611-17878633 CCGGGAGCTGCGGGCGGGGCGGG - Intronic
927698289 2:25252069-25252091 GCGGCTGCTGCGGGCCGGGGAGG + Intronic
927714120 2:25341644-25341666 GCGGGGACGGCGGGCCGGGCTGG - Intronic
929165412 2:38876326-38876348 GCGGAAACTGAGGCCCAGGGAGG - Intronic
929188691 2:39120700-39120722 GCGGCGCCGGCGGGCCGGGGAGG - Intronic
929788763 2:45009379-45009401 GAGGGAACGGCGGGCGGGCGCGG - Exonic
930565967 2:53020994-53021016 GAGGGAACTGAGGCTCGGGGAGG - Intergenic
931309651 2:61066068-61066090 GCGGGAAGTGCGGCATGGGGCGG + Intronic
932363476 2:71130114-71130136 GTGGGAACGGCGGTCGGGGGCGG - Intronic
933953850 2:87352106-87352128 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
934059987 2:88284364-88284386 GCTGGAGCTGCGGGCCGCTGGGG - Intergenic
934238050 2:90248352-90248374 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
934275149 2:91568384-91568406 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
934460466 2:94211688-94211710 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
934556542 2:95289670-95289692 GAGGGAAGTGGGGGCCAGGGGGG - Exonic
935155360 2:100479585-100479607 GAGGAAACTGAGGCCCGGGGAGG - Intronic
935595165 2:104872544-104872566 GCGGGAACTCGGGGACCGGGAGG - Intergenic
938118815 2:128619873-128619895 GGGGGAACTGAGGCCTGGGGCGG + Intergenic
938318333 2:130345445-130345467 GCGGGAACTGGGGTCTCGGGAGG - Exonic
938500509 2:131829506-131829528 CGTGGAACTGCGGGGCGGGGCGG + Intergenic
939990885 2:148875934-148875956 CCGGGAGCGGCGGGCCGGGCGGG + Intronic
940420998 2:153478855-153478877 GTGGGAGGTGCGGGCCGCGGCGG + Intergenic
940911008 2:159210056-159210078 GAGGGCACTGCGGGCAGGGCAGG - Intronic
941029425 2:160493862-160493884 GGGGGAAGGGCGGGCGGGGGCGG + Intergenic
942965951 2:181892240-181892262 CCGGCAGCTGCGCGCCGGGGAGG - Exonic
946185585 2:217978876-217978898 GCGCGGATTGCGGGCTGGGGTGG - Intronic
946306486 2:218859625-218859647 GCGGGAGCGGGGTGCCGGGGCGG - Intergenic
946329819 2:219002725-219002747 GCGGGAACTTAGGGCCCGGGAGG - Intergenic
946496533 2:220201365-220201387 GCAGGAACTGAGGGCCCGAGAGG + Intergenic
946966567 2:225042747-225042769 GGGGGAACTGCAGGCTGCGGGGG + Intergenic
947122938 2:226836162-226836184 GCGGGAGCTGGCGGCCGGGCTGG + Intronic
947399122 2:229714587-229714609 GCGGGGCCTGCGGGGCGGGGCGG + Intergenic
947860500 2:233354482-233354504 GCGCGCACCGCGGGCGGGGGCGG - Intergenic
948515874 2:238503659-238503681 ATGGGAACTGCGGGCCTGTGTGG + Intergenic
948665546 2:239532682-239532704 GAGGGAGCTGTGGGCCTGGGTGG - Intergenic
948862423 2:240759248-240759270 GGGGGCACTGCAGGCTGGGGAGG + Intronic
949050448 2:241894979-241895001 GCGGCAGCTGCGGGCAGGTGGGG - Intronic
1170998659 20:21391696-21391718 GCGGGGTCTGCGGGCTGGGCCGG - Intergenic
1172083240 20:32358723-32358745 GCGGGACCTCCGGGCTGGGCGGG - Exonic
1172245639 20:33443563-33443585 GCTGGAGCTGCGCGCCGGGGCGG - Exonic
1172277337 20:33686678-33686700 GCGGGAGCGTCGGGGCGGGGCGG - Intergenic
1172938415 20:38637763-38637785 GCGGGACCTGTGTGCTGGGGAGG - Exonic
1174204430 20:48828321-48828343 GCGGTGACTGCGGGTTGGGGGGG - Intergenic
1175244516 20:57573509-57573531 GAGGGAACTGTGGGCAGGAGGGG + Intergenic
1176056430 20:63151457-63151479 GCGGGAGCTGCAGGCCTGAGGGG - Intergenic
1176120911 20:63454227-63454249 GCAGGGTCTGCGGGCCGGCGAGG - Intronic
1178534872 21:33403287-33403309 CCGGGAACCGCGGCCCTGGGGGG - Exonic
1178916667 21:36708899-36708921 GCGGGAGCTGTGGGCCTGGCAGG + Intronic
1179911855 21:44455113-44455135 GCGGGGTCTGCGCGCCGGGAGGG - Intergenic
1180099738 21:45578970-45578992 CCAGGAACTGCAGGCCAGGGTGG - Intergenic
1180570927 22:16718107-16718129 GCGGTAGCTGCAGGCAGGGGAGG - Intergenic
1180799160 22:18623801-18623823 GAGGGAAGTGCAGGCCAGGGGGG - Intergenic
1181023993 22:20117394-20117416 GCGGGAAGCGCGGGGCGGGCCGG + Intronic
1181222558 22:21371465-21371487 GAGGGAAGTGCAGGCCAGGGGGG + Intergenic
1181355781 22:22295067-22295089 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1181902276 22:26166422-26166444 GAGGAAACTGAGGGCCAGGGAGG - Intergenic
1183540582 22:38427212-38427234 GTAGGAGCTGCGGGCCTGGGTGG + Exonic
1183893725 22:40951200-40951222 CCGCGAACTGTAGGCCGGGGAGG - Intergenic
1184570920 22:45324396-45324418 GAGGGAAGTGCGGGGAGGGGAGG + Intronic
1184668016 22:45998638-45998660 GTGGGCTCTGCGGGCCGGGCAGG - Intergenic
950004307 3:9681872-9681894 GCAGGAACTACAGGCTGGGGAGG - Intronic
950085786 3:10256746-10256768 GCGGGAGCAGAGGGCAGGGGTGG + Intronic
950153735 3:10707680-10707702 GCGGGCGGGGCGGGCCGGGGTGG - Intronic
952367236 3:32685514-32685536 GCGGGACGTGCGGGGCCGGGCGG + Intronic
953397023 3:42581721-42581743 GCCGGGACTGAGGGCCGGGTGGG + Intronic
953484934 3:43286467-43286489 GCGGGAAGGGCAGGGCGGGGCGG - Intergenic
953905777 3:46867651-46867673 GCGGGACCGGCAGGCCAGGGCGG - Intronic
954110190 3:48429269-48429291 GCGGGATGTGCGCGCCGAGGCGG + Exonic
957107269 3:75906750-75906772 GCGGTAGCTGCAGGCAGGGGAGG + Exonic
960101169 3:113745581-113745603 CCTGGAGCTGCGGGCCGGCGTGG + Intronic
961039454 3:123666998-123667020 GCTGGAACTGAGGGTGGGGGTGG + Intronic
961384187 3:126515433-126515455 GTGGGCACTGGGGGCAGGGGAGG - Intronic
961469394 3:127101753-127101775 GGGGAAACTGAGGGCCGGGAAGG + Intergenic
961612802 3:128153821-128153843 GCGGTGAGCGCGGGCCGGGGCGG + Exonic
962007445 3:131362264-131362286 GCTGGAACTGCTGGGCGAGGCGG + Intergenic
965615127 3:170585614-170585636 GCGGGAGCTGCCGGGCGGGGCGG - Intronic
966103383 3:176304280-176304302 GCAGGAACTGCGGGGAGTGGAGG + Intergenic
966794293 3:183698480-183698502 GCGGGCAGTGCGGGGCGGAGTGG + Intronic
967370994 3:188745879-188745901 GAGGGAACTGAGGCCCGTGGTGG + Intronic
968092971 3:195909596-195909618 GCGGGAGGGGAGGGCCGGGGCGG - Intronic
968490436 4:888133-888155 GCAGGAACTGCGGCCCCTGGTGG - Intronic
968660024 4:1795001-1795023 GCGGGCGCGGCGGGCCGGGGAGG + Intronic
969721292 4:8894211-8894233 GCGGGAGCGCAGGGCCGGGGCGG - Intergenic
972633016 4:40857801-40857823 GGGGGAAATGGGGGGCGGGGAGG + Intronic
973754747 4:54064136-54064158 GCGGGAGGTGCGGGCTGGGGTGG - Intronic
980130462 4:128811959-128811981 GCGGCACCTTCGGGCTGGGGCGG - Intronic
981128529 4:141133056-141133078 GCGGGAACAGAGGGCCCGCGGGG + Intronic
982435132 4:155376663-155376685 GCGGGACCTGGGGGCCATGGGGG - Intronic
984928389 4:184826108-184826130 GCGGGGCCTGCGGGCGGGGCGGG - Intronic
984966366 4:185143513-185143535 GCGGGCGCGGCGGGCCGGGCGGG + Intronic
985298188 4:188457744-188457766 GGGAGAACTGGGGGCCGGGGCGG + Intergenic
985897248 5:2756026-2756048 GCGGCTACTGTGGGCCGGGAGGG + Intergenic
988595393 5:32585866-32585888 GCGGGCGCTGCGGCCCGGGGCGG + Intronic
990467833 5:56086511-56086533 GCGGGAAGTGGGGGCGGGGGAGG - Intergenic
992067401 5:73120504-73120526 GCGGGCGCGGCGGCCCGGGGAGG - Exonic
992473129 5:77077311-77077333 CCGGGAACTGCAGGCCGAGCGGG - Exonic
994710587 5:103259421-103259443 GCGGGAACAGCGGCCAAGGGAGG - Intronic
995787125 5:115841995-115842017 GTGGGCACTGGGGGCCAGGGCGG - Exonic
997139317 5:131362006-131362028 GGGGGCACGGCGGGCCAGGGTGG + Intronic
997201327 5:132011680-132011702 GCGGGAGCTGCGGGGCCGGAGGG - Intronic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
998583357 5:143403233-143403255 GCGGGAACTGCGGACGGTGGCGG - Exonic
1001531602 5:172466062-172466084 GGGGGAATTGGGGGCGGGGGTGG + Intergenic
1002042089 5:176521805-176521827 GCGGGAGCTGGGAGCCGGTGAGG - Intergenic
1002046050 5:176542466-176542488 GTGAGAACTGCGGGTTGGGGAGG - Intergenic
1002058229 5:176610582-176610604 GCCGGAAGTGCGGCCGGGGGTGG - Intergenic
1002184267 5:177446970-177446992 GCGGCGGCTGCGGGCCGGGCGGG + Intronic
1002277529 5:178113651-178113673 GCCGGGACTGCGTGCCGGGTCGG - Exonic
1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG + Intronic
1002696878 5:181098040-181098062 GCAGGAGCCCCGGGCCGGGGCGG - Intergenic
1002697744 5:181101333-181101355 GCAGGAGCCCCGGGCCGGGGCGG + Intergenic
1002915349 6:1524186-1524208 GCCGCAACCGCGGGCCGAGGGGG + Intergenic
1003261013 6:4516150-4516172 GCGGAACCTGCGGGTGGGGGAGG + Intergenic
1003552258 6:7109253-7109275 GCGGGAAGTTGGGGGCGGGGGGG - Intronic
1005040687 6:21596735-21596757 GCGGGAGCTAGGGGCGGGGGCGG + Exonic
1005765882 6:29011696-29011718 GCGGGAACTCTGGGGCGGGGCGG + Intergenic
1006502041 6:34465562-34465584 GCAGAAGCTGCGGGCAGGGGTGG + Intergenic
1008545113 6:52577103-52577125 GCGGGGGCTGCGGCCGGGGGCGG - Intergenic
1010043974 6:71420101-71420123 GTGGGGACTGCGGGGCGGGCCGG - Intergenic
1010926637 6:81752794-81752816 GCGTGCCCTGCGGGCGGGGGAGG - Intergenic
1017920738 6:158869868-158869890 GCGCGACCGGCGGGGCGGGGCGG + Intergenic
1018494651 6:164337335-164337357 GAGTGAACTGCGGGACGCGGAGG - Intergenic
1018898143 6:168035446-168035468 GCGGGAACGGCGCTGCGGGGGGG + Intronic
1019319919 7:410956-410978 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019319930 7:410992-411014 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019319955 7:411064-411086 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019319994 7:411172-411194 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019320006 7:411208-411230 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019320017 7:411244-411266 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019320041 7:411316-411338 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019320065 7:411388-411410 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019320114 7:411532-411554 GCGGGTCCTGCGGGCTGGAGAGG - Intergenic
1019358366 7:592556-592578 GCGGGGGCTGAGGGGCGGGGAGG + Intronic
1019485527 7:1287608-1287630 GCGGAAACTGAGGCCCAGGGAGG - Intergenic
1019510897 7:1416803-1416825 GCTGGAAATGAGGGCTGGGGAGG - Intergenic
1019521303 7:1461663-1461685 GCGGGTGCTGGGGGCCGGTGCGG - Intergenic
1019743741 7:2688339-2688361 GAGGGACCTCCGTGCCGGGGCGG + Intronic
1019989524 7:4682140-4682162 GCGGGACCGGCGGGCGGGCGAGG + Intergenic
1020254953 7:6497815-6497837 GAGTGACCTGCAGGCCGGGGAGG - Exonic
1026577573 7:71585869-71585891 GCGGGAAGTGTGGGGTGGGGAGG - Intronic
1026852871 7:73735827-73735849 GCGGGAGCTGGAGGCCTGGGAGG + Intergenic
1026858659 7:73770664-73770686 CCCGGAACGGCGGGGCGGGGAGG + Intergenic
1026866626 7:73828073-73828095 GCGGGGGCCGGGGGCCGGGGGGG + Intronic
1029169216 7:98618599-98618621 GCGGGAGCGGGGGGCGGGGGGGG - Intronic
1029270582 7:99374775-99374797 GCGGGAGGTGAGGGCCGTGGGGG + Exonic
1029362982 7:100100696-100100718 GAGAGAGCTGCGGCCCGGGGGGG - Intronic
1031495490 7:122442380-122442402 GTGGGAACTGCAGTCCTGGGAGG - Intronic
1031919189 7:127588748-127588770 CCCGGAGCTGCGGGCCTGGGTGG + Intronic
1032306259 7:130734271-130734293 GGGTGTCCTGCGGGCCGGGGCGG - Intergenic
1034618336 7:152436819-152436841 CGGGGAACTGCGGGCGAGGGCGG + Intergenic
1034878819 7:154748569-154748591 GCGAGCCCTGCGGGGCGGGGAGG + Intronic
1035153309 7:156892866-156892888 GCGGGGACGGAGGGCCCGGGCGG + Intronic
1035404188 7:158587567-158587589 CCGGGAGCTGCCGGCCGCGGGGG + Exonic
1037879384 8:22565648-22565670 GCGGGAACTAGGGGAAGGGGCGG - Intronic
1037883207 8:22582913-22582935 GCGGGAGATGGGGGCGGGGGGGG - Intronic
1038415189 8:27389820-27389842 GCGGGAACTGAGGGCTGAGAGGG + Intronic
1038450028 8:27633920-27633942 GCGGGAAGCGCGGGCGGCGGCGG + Intronic
1041792669 8:61714439-61714461 GCGGGAACCGCTGGCGGCGGCGG + Exonic
1042307122 8:67343633-67343655 CCGGGAACTGAGGGACGAGGTGG + Exonic
1042611636 8:70607715-70607737 GAGGGGCCTGCGGGCGGGGGCGG - Intronic
1044734797 8:95268741-95268763 GCGGGCTCTGCGGGCGGGGCGGG + Intronic
1045231379 8:100310101-100310123 GCGGGGGCTGCGGGAGGGGGAGG - Intronic
1047454804 8:124998873-124998895 ACGGGGGCTGCGGGCCGGCGCGG - Exonic
1049109889 8:140635871-140635893 GTGGGAACCGCGGGCGGGAGCGG + Intergenic
1049471792 8:142777974-142777996 GCGGGAGCTGAGCGCAGGGGAGG - Exonic
1049548588 8:143246262-143246284 GCGGGAGCTGGGGGTCGGCGGGG + Intergenic
1049684238 8:143932933-143932955 GCAGGACCTGCTGGCCTGGGTGG - Exonic
1049689329 8:143951872-143951894 GCGGCAGCAGCGGGGCGGGGAGG - Intronic
1049762453 8:144337391-144337413 GCGGGATCTGCGGGGGCGGGCGG + Intergenic
1049830651 8:144699295-144699317 GCGGGCGCTGTGGGGCGGGGTGG + Intergenic
1049988417 9:972150-972172 GCGGGAACTGGGAGGAGGGGAGG - Intergenic
1050091030 9:2016539-2016561 GCGGCGGCTGCGGGCCCGGGAGG + Intronic
1052837823 9:33264750-33264772 GCGGGGCCGGCAGGCCGGGGCGG - Exonic
1053416777 9:37951817-37951839 GCTGGATCTGGGGGCCGGGCCGG + Intronic
1053690963 9:40587385-40587407 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1054302223 9:63388356-63388378 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1054495784 9:65822505-65822527 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1057186066 9:93058280-93058302 ACGGGAGGGGCGGGCCGGGGAGG + Intergenic
1057361076 9:94374465-94374487 GCGGGAGCTGAGGTGCGGGGCGG + Intergenic
1057600086 9:96450251-96450273 GCGACCACTGCGGGCCCGGGAGG - Exonic
1057662266 9:97013641-97013663 GCGGGAGCTGAGGTGCGGGGTGG - Intergenic
1057883038 9:98807731-98807753 GCGGGAACTGCGGCGCGGCCGGG + Exonic
1060745919 9:126130926-126130948 GCGGGGAAGGAGGGCCGGGGCGG + Intergenic
1060945758 9:127568737-127568759 GCGCCAACTGCTGGCCGGGGCGG + Intronic
1060979672 9:127785260-127785282 GGGGGCACTCCGAGCCGGGGAGG + Intergenic
1061787050 9:133035650-133035672 ATGGGAACTGCGGTCGGGGGAGG + Intronic
1061866220 9:133493003-133493025 GCAGGGACTGGGGGCTGGGGAGG + Intergenic
1061978827 9:134088099-134088121 GCGTGAACTGCAGGCCAGGCTGG - Intergenic
1062327473 9:136019147-136019169 GGGTGAGCTGGGGGCCGGGGAGG - Intronic
1062400547 9:136370772-136370794 GCGGGGTCTGCAGGCCGGGGCGG - Intronic
1062421287 9:136483823-136483845 GCCGGAGCTGCGGGACGCGGAGG + Exonic
1062472490 9:136712586-136712608 GCGGCCGCTGCGGGCCGGGCCGG + Exonic
1062499187 9:136845062-136845084 CGTGGAACTGCGGGGCGGGGCGG - Exonic
1062734462 9:138127425-138127447 GCGGGGACTGCGGGGCCGTGTGG - Intergenic
1186355451 X:8784505-8784527 GCGGGGACTGCGGGGTGGAGAGG + Intergenic
1187181390 X:16946709-16946731 GCGGCAGCTGCGGGGCGTGGGGG + Exonic
1188482867 X:30652924-30652946 GCGGGAAGGCCGGGCCGGGTAGG + Intergenic
1189324956 X:40106394-40106416 GCGGGGACTCCGGGCCCGCGGGG - Intronic
1189333113 X:40155015-40155037 GGGCGCACTGCGGGCCGCGGCGG - Intronic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1192261050 X:69505957-69505979 GGGGGACCTGCTGGCCGTGGTGG + Exonic
1198205329 X:134460111-134460133 GCGGGGCCTGCGGGGCGTGGCGG + Intergenic
1198803356 X:140469778-140469800 GCTGGAATTGTGGGCCCGGGTGG + Intergenic
1199881097 X:151974740-151974762 GCGGGGAGCGCGGGACGGGGCGG - Intergenic
1200033233 X:153312770-153312792 GCAGGGACTGCAGGCCTGGGAGG + Intergenic
1201189664 Y:11436082-11436104 CCGGGAACTGGGGTCTGGGGTGG - Intergenic