ID: 1100680725

View in Genome Browser
Species Human (GRCh38)
Location 12:96917019-96917041
Sequence TTTTATCTTGAGAAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 1, 2: 8, 3: 92, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100680725 Original CRISPR TTTTATCTTGAGAAACTGGA TGG Intronic
900774812 1:4574665-4574687 TTGTGGCCTGAGAAACTGGAAGG + Intergenic
902284722 1:15400021-15400043 TTTCACCTAGAGAAGCTGGAAGG - Intronic
902306525 1:15543853-15543875 TTTTGCCCTGAGTAACTGGAAGG + Intronic
902895574 1:19477516-19477538 TTTTGTGCTCAGAAACTGGAAGG - Intronic
903098483 1:21004284-21004306 TTTTATCTTCAGAAAATATATGG - Intronic
903756958 1:25668968-25668990 TTTTATGGGGAGAAACTGAAAGG + Intronic
905236067 1:36549397-36549419 TTCTATCTTAAGAAACTGGGTGG - Intergenic
905543791 1:38781562-38781584 GTCTAACTTGAGTAACTGGATGG - Intergenic
905756275 1:40512175-40512197 TTTAATCTTAAGAAACTGGGCGG - Intronic
906220181 1:44072182-44072204 TTTTTGCCTGAGCAACTGGAAGG + Intergenic
906485970 1:46235265-46235287 TTCTACCTTAAGAAGCTGGAGGG - Intergenic
907353505 1:53853085-53853107 TTCTATCTTGGGTGACTGGATGG + Intronic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
910114512 1:83717161-83717183 TTTTATCTGAACACACTGGATGG + Intergenic
910516077 1:88061460-88061482 TTTTCTTTTGAAAAACAGGAAGG - Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911251072 1:95576815-95576837 TTTTAGCCTGAGCAGCTGGAAGG - Intergenic
911556087 1:99346763-99346785 TTTTAACATGAGAAATTGGATGG + Intergenic
913143743 1:115968270-115968292 TTTAATCCTGAGAAACTGTGAGG + Intergenic
913148310 1:116014194-116014216 TTTCCTCTTTAGGAACTGGAAGG + Intronic
913371465 1:118104294-118104316 TTTTAGTTTGAGCAACTGGGTGG + Intronic
914576833 1:148979548-148979570 TTTTATCTTTAAAACCTGTAAGG - Intronic
914945827 1:152065236-152065258 TTCTGGCTTGAGAAACTGGAAGG - Intergenic
914960230 1:152198601-152198623 TTTTATCTTGAGTAATTGCATGG + Intergenic
916200678 1:162268349-162268371 TTTTCTCTGGATAAACTGAATGG + Intronic
916474688 1:165157972-165157994 TTTTGGCTTCAGTAACTGGAAGG - Intergenic
916640986 1:166729009-166729031 TTTTATCTTGAAAATCTGGTAGG - Intergenic
916837027 1:168556087-168556109 TTTTATCTGGAGACCCTGGTTGG + Intergenic
916948238 1:169752084-169752106 TCTTATCTTGATAGACAGGAGGG + Intronic
917198862 1:172494877-172494899 TTTTAAGTTTACAAACTGGACGG - Intergenic
917623124 1:176818461-176818483 TTTTGTCCTGAGCAACCGGACGG - Intronic
918332803 1:183475347-183475369 TTTTATCTGGACAAAGTGGTCGG + Intronic
918467160 1:184832346-184832368 TGTTTTGTTGGGAAACTGGAAGG - Intronic
918480107 1:184969381-184969403 TTTTATCTTGATGAGCAGGAGGG - Intronic
919071657 1:192763267-192763289 TTTTGACTTGAGCAACTGGAAGG - Intergenic
919145069 1:193623851-193623873 TTATTTCTTGAGAAACATGAAGG - Intergenic
919479926 1:198075622-198075644 TTTTATCTTGATAAGAAGGAAGG - Intergenic
919493694 1:198237469-198237491 TTTTAACCTCAGCAACTGGAAGG - Intronic
919610581 1:199741219-199741241 TTTTTTCTTGAGCAACTAGAAGG - Intergenic
919734091 1:200934515-200934537 TTTTCTCTTTAGAAACGAGAAGG + Intergenic
920067833 1:203281695-203281717 GTTTATCTGGAGAAACAAGACGG - Intergenic
920537863 1:206751824-206751846 GTTTATCTTGAGAACGTGTATGG - Intergenic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
921717577 1:218434074-218434096 TTTGGACTTGAGAATCTGGAGGG - Exonic
921818951 1:219594695-219594717 ATTTTTCTTGAAAAATTGGATGG + Intergenic
922818080 1:228465222-228465244 TTTTAACTGGAGAAATTGAATGG + Intergenic
923057288 1:230436440-230436462 TGTTATCTTGACAAAATAGAAGG + Intergenic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
923454181 1:234148878-234148900 TTTTAGCTTGAGCAACTGGATGG + Intronic
923486274 1:234434510-234434532 TTTTGGCTTAAGAAACTGGCAGG + Intronic
924190501 1:241546641-241546663 TTCTAGTTTGAGCAACTGGATGG + Intronic
924279106 1:242418216-242418238 TTTTAGCCTGAGCAACTGGAAGG + Intronic
924362090 1:243253332-243253354 TTTTACCTTGTGAAAATGTATGG - Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924542632 1:244995659-244995681 TTTTATTATGCGCAACTGGAAGG + Intronic
1062907644 10:1189662-1189684 TGTTATCTTGAGGAACAGGGTGG - Intronic
1063014019 10:2056917-2056939 ATTTATCTTGGTAATCTGGATGG + Intergenic
1063080177 10:2760475-2760497 TTTTGTCTTAAGGAACTAGAAGG + Intergenic
1063923599 10:10955851-10955873 TTTCCTCTTGAGTAACTTGAAGG - Intergenic
1064085515 10:12343277-12343299 TTTTTCCCTGAGAAAATGGAAGG + Intergenic
1064895696 10:20233761-20233783 ATTTTTTTTGAGACACTGGATGG - Intronic
1065068655 10:22000079-22000101 TTTTGGCTTCAGTAACTGGAAGG - Intronic
1066393711 10:34999036-34999058 TTTTGGCCTGAGAAACTGGAAGG + Intergenic
1066433435 10:35374318-35374340 TGTGTTCCTGAGAAACTGGAAGG - Intronic
1066504497 10:36027353-36027375 TTTTGGCTTGAGCAACTGCAAGG + Intergenic
1066534260 10:36373431-36373453 TTTTATCTTGAGAAGCTTCTAGG - Intergenic
1066550228 10:36547758-36547780 TTTTGGCTTGAGAAATTAGAAGG - Intergenic
1068293940 10:55042818-55042840 ATTTATATTGAAAGACTGGAAGG - Intronic
1068894281 10:62182247-62182269 TTTTGACCTGAGCAACTGGAAGG + Intergenic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1069252429 10:66286440-66286462 TTTGATCTTGAGCAATAGGATGG - Intronic
1069362347 10:67657165-67657187 TTCGATCTGGAGCAACTGGAAGG + Intronic
1069395885 10:67987287-67987309 TTTTACCTCGAGAAAATGGAAGG - Intronic
1069400925 10:68045313-68045335 TTTTATCTTGAGACACGGTCTGG - Intronic
1072704792 10:97673334-97673356 TTGTATCTTTACTAACTGGAGGG + Intronic
1074617574 10:115085066-115085088 TTTGATTTTGAGAAACAGAAAGG - Intergenic
1075321347 10:121493891-121493913 TTCCAGCTTGAAAAACTGGATGG - Intronic
1075632486 10:124009499-124009521 TTACATCTGAAGAAACTGGAGGG + Exonic
1076496877 10:130903408-130903430 TTTTATTTTGAGACTCTGAAAGG - Intergenic
1078606288 11:12778856-12778878 TTTTATCTTGAGAAACCACCTGG + Intronic
1079010465 11:16823774-16823796 TTTTGACTTGAGCAACTGGACGG - Intronic
1079062768 11:17263999-17264021 GTTTAGCTTGAGCAACTGAATGG + Intronic
1079798705 11:24841613-24841635 TTCTTTCTTGAGAAATTGGAAGG - Intronic
1080239071 11:30105634-30105656 TTTCAGCTTGAGAAACTAGAAGG + Intergenic
1080555188 11:33409703-33409725 TTTTAAATTGAGAAAGGGGATGG - Intergenic
1080781543 11:35434349-35434371 TTTCATATTGAGATACTAGATGG - Intronic
1081251216 11:40836912-40836934 TGTGATGTTGAGGAACTGGATGG - Intronic
1082974872 11:59061524-59061546 TTTTGACTTGAGCAACTAGAAGG - Intergenic
1082979296 11:59105258-59105280 TTTTGACTTGAGCAACTAGAAGG - Intergenic
1083139490 11:60710404-60710426 TTTTGTCCCGAGCAACTGGAAGG - Intronic
1083285086 11:61653490-61653512 TTTGAACTAAAGAAACTGGAAGG + Intergenic
1083451538 11:62749272-62749294 TTTGAAGATGAGAAACTGGAAGG - Intronic
1085218681 11:74854045-74854067 TTTTGCCTTGAGTAACTGGATGG + Intronic
1086604182 11:88675327-88675349 TTTAATATTGAGTAAATGGACGG + Intronic
1086637573 11:89107492-89107514 TTTTATAATGAAAAACTGGGAGG + Intergenic
1087283687 11:96241459-96241481 TTTTAACTTTTGTAACTGGAGGG + Intronic
1087520289 11:99224873-99224895 ATTTATTTTGAAAAACTGGAAGG + Intronic
1087613182 11:100458211-100458233 TTTTGTCCTGAGCAACTGGAAGG + Intergenic
1088329849 11:108640053-108640075 TTTTAACCTGAGAAACTCAAAGG + Intergenic
1088629199 11:111757940-111757962 TTTTTGCTTGAGCAACTGGGTGG - Intronic
1089223376 11:116894493-116894515 TTCTATCCTGAGCAAATGGAAGG - Intronic
1090434550 11:126675981-126676003 TTTTGGTTTGAGAAGCTGGATGG + Intronic
1091240558 11:134049447-134049469 TGTGACCTTGAGAAACTGCAGGG - Intergenic
1091831884 12:3555919-3555941 TTTTGACTTGGGAAACTGGGTGG + Intronic
1092275918 12:7060861-7060883 TTTTACCTTCAGAAGCTGGTAGG - Intronic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1093535331 12:20216665-20216687 TTTCAGCTGGAGCAACTGGAAGG + Intergenic
1093543953 12:20322335-20322357 TTTTATTTTGAGAGACTAGCTGG - Intergenic
1093743181 12:22711452-22711474 TTCTAGCCTGGGAAACTGGATGG - Intergenic
1093854847 12:24089116-24089138 TTTTATCTTCTGAAAATGTATGG - Intergenic
1093903940 12:24666899-24666921 TTTGTCCCTGAGAAACTGGAAGG + Intergenic
1094663905 12:32499243-32499265 TTTTATCTTAAGAACCTTTATGG + Intronic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1096281064 12:50254246-50254268 TTTTAGCTTCAGAGACTAGAAGG + Intronic
1097468791 12:59961761-59961783 TTTTGGCTTAAGAAACTGGGTGG + Intergenic
1097472094 12:60006999-60007021 TTTTATCTTGAGAATTTCGCTGG - Intergenic
1098215956 12:68219648-68219670 TTCTAGCTTAAGAAACTAGAAGG + Intronic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1100246173 12:92759304-92759326 TTTTATTTTGACAAACAGGCAGG - Intronic
1100275012 12:93063898-93063920 TTTTGGCTTGAGCCACTGGAAGG - Intergenic
1100289979 12:93204508-93204530 TCTTATTTGGAGAAACTGAATGG + Intergenic
1100604954 12:96143986-96144008 TTTTGACTTGGGAAACTGAAAGG - Intergenic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100828658 12:98498025-98498047 TTTTGGCCTGAGCAACTGGAAGG - Intronic
1101006648 12:100407482-100407504 TTTTTTCTGCAGAAACTAGAAGG + Intronic
1101691924 12:107090939-107090961 TTTTGGCTTGAGAAACTGGAAGG - Intronic
1103202403 12:119098732-119098754 TTTGAGCCTGAGCAACTGGAAGG - Intronic
1104066010 12:125306524-125306546 TTTTAGCCTGAGAAGCTAGAAGG - Intronic
1104132135 12:125904607-125904629 TTTTAACTTCAGGTACTGGAAGG + Intergenic
1104701799 12:130910393-130910415 TTTCATCTTGAGACATTGTATGG - Intergenic
1105447525 13:20470585-20470607 TTTTGTCTTGAGACTCTGGGAGG - Intronic
1106516000 13:30454496-30454518 TGTTATATATAGAAACTGGAAGG + Intergenic
1106563572 13:30866885-30866907 ATTTATGTTGAGCAACTGCAAGG - Intergenic
1106577202 13:30986472-30986494 TTTTAGGTTAAGAAACTAGAGGG - Intergenic
1107719160 13:43229814-43229836 TTTTCACTTGAGCAACTGGGTGG + Intronic
1108596138 13:51951286-51951308 TTTCATTTTGAGCAACTGGGTGG + Intronic
1109966443 13:69704251-69704273 TTCTATCTTGAACAACTGGATGG - Intronic
1110536381 13:76655245-76655267 TTTTAACTTGAGCAACTAGAAGG + Intergenic
1110578771 13:77093611-77093633 TTTTAGCTTAAGCAACTGGATGG - Intronic
1110662494 13:78073478-78073500 TTTCTTCTTGAGCAACTGGATGG - Intergenic
1111698546 13:91657326-91657348 GTGTATCTTGGGAAACTGGATGG + Intronic
1111759072 13:92438829-92438851 TTGTAGCTTGAGCCACTGGAAGG + Intronic
1111925861 13:94462804-94462826 TTGAATCTTGAGTAACTGAAGGG + Intronic
1111931749 13:94519697-94519719 TTCTATCTTGAGAAAAGGTATGG + Intergenic
1112589238 13:100748622-100748644 TTTTATCTCCAGAACCTGCAAGG - Intergenic
1112814591 13:103256934-103256956 TTTGGTCTTGAGTAACTGAAAGG - Intergenic
1112880318 13:104098985-104099007 TTCACTCTTGAGAAAATGGAGGG + Intergenic
1113322574 13:109250089-109250111 TTTAATCTTGGGTAACTGTAGGG + Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113635608 13:111917008-111917030 TTCCATCTTGAGGAACTGGGGGG + Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1114426483 14:22628192-22628214 GTTTATCTAGAGAAAATGTATGG + Intergenic
1116380786 14:44265133-44265155 TTTTATCCTGAAAAACTGGAAGG + Intergenic
1116447260 14:45024231-45024253 TAATAACTTGAGAAAGTGGAGGG + Intronic
1116815675 14:49581474-49581496 TTTTGGCCTGAGCAACTGGAAGG - Intronic
1116886067 14:50223117-50223139 TTTTAGTTTGAGCAACCGGAAGG + Intronic
1117575455 14:57092743-57092765 TTTTAGCCTGAGCAACTGGAAGG + Intergenic
1117654644 14:57942379-57942401 TTAGAACTTGAGATACTGGATGG - Intronic
1118034917 14:61856517-61856539 TTTTGCCCTGAGAAACTGGAGGG + Intergenic
1118121209 14:62845693-62845715 TTTTGTCTTAAGCAACTGAAAGG + Intronic
1118894363 14:69933252-69933274 ATTTATTTTCAGAAACAGGATGG + Intronic
1118993819 14:70819694-70819716 TTTTGGTTTGAGCAACTGGAAGG + Intergenic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120234966 14:81880256-81880278 TTTTTTCTTGAGAAATTTGAAGG + Intergenic
1121210169 14:92202527-92202549 TTGTGTCTTGAGAACCTGGGTGG - Intergenic
1121375603 14:93407481-93407503 CTTTATCATGAGAACCTGGTGGG - Intronic
1122386826 14:101354481-101354503 TTTTATTTTTAGAAAATGCATGG + Intergenic
1123180957 14:106469774-106469796 TCCTAGCTTGAGAAACTTGATGG - Intergenic
1124070370 15:26387212-26387234 ATCTATCTTAAGAAACTAGAAGG - Intergenic
1125045055 15:35235707-35235729 TTTTAGCTTTTGAAAATGGAGGG + Intronic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126526126 15:49656648-49656670 TATTTGCTTGAGAAACTGGAAGG - Intergenic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1127693705 15:61423071-61423093 TGATATGTTGAGAAACTGGCTGG + Intergenic
1127880355 15:63151915-63151937 TTCAATTTTGAGAAACTGTATGG + Exonic
1128581835 15:68816241-68816263 TTTTTTCTTAAGATACTGTAAGG - Intronic
1129508605 15:76103475-76103497 TTTTGGCCTGAGCAACTGGAAGG + Intronic
1129643905 15:77412424-77412446 TTTTGACTTGAGCAACTGGAAGG - Intronic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132089963 15:98940212-98940234 ATTTATCCTGAGAAACTGCAGGG + Intronic
1135097528 16:19577053-19577075 TTTGATCTTTACAAACTGGTGGG - Intronic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1138225761 16:55292934-55292956 TTTGATCCTGAGCACCTGGAGGG + Intergenic
1138751067 16:59421695-59421717 TGTTATCTTCAGAATCTGTATGG + Intergenic
1138921767 16:61539086-61539108 TTTCACCTTGTGAAACTGGAGGG - Intergenic
1140217638 16:73021303-73021325 TTTTAACTTGAGTGACTGGAAGG - Intronic
1140278636 16:73533738-73533760 TTTTTTCTTGAGCAAATGGAGGG - Intergenic
1140590645 16:76348199-76348221 TTTTGTACTGAGAAACTGGAAGG + Intronic
1140736855 16:77906205-77906227 TTTAATGTTGAGAGCCTGGAGGG + Intronic
1140778797 16:78275260-78275282 GTTTCTCTTAAAAAACTGGAAGG + Intronic
1144274709 17:13654959-13654981 TTTTATTTTGTAAAACAGGAAGG + Intergenic
1144576160 17:16431015-16431037 TTTTATTTTGTGACCCTGGAAGG + Intronic
1146486730 17:33249169-33249191 TTTTCACTTGAACAACTGGAAGG + Intronic
1146556595 17:33830344-33830366 TTTTATTTTGACAAAAAGGAGGG - Intronic
1147486600 17:40821103-40821125 TGTTAGGTTGAGAATCTGGAGGG + Exonic
1147865393 17:43548671-43548693 TTTTTTTTTGAGAGACAGGAGGG + Intronic
1148184968 17:45636145-45636167 TTTTGGCCTGAGCAACTGGAAGG + Intergenic
1150742277 17:67788935-67788957 TTTTAGCCTGAGCAACTGGAAGG - Intergenic
1151111541 17:71683745-71683767 ATTTATGTTGAGAAAGAGGAGGG - Intergenic
1154097053 18:11427977-11427999 TACTATCTATAGAAACTGGAAGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1156035879 18:32768590-32768612 TTTTATCATGAGAAACTGAGAGG + Intronic
1156232695 18:35169858-35169880 TTTTGTCTTGAGGAACTATAAGG - Intergenic
1156248429 18:35326633-35326655 TATTAGCCTGAGCAACTGGAAGG + Intergenic
1156531965 18:37825966-37825988 TTTTATCTAAAGAAAATAGAAGG + Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1157516325 18:48314378-48314400 TTATAACTTGAGAATCTTGAGGG - Intronic
1159121628 18:64177869-64177891 ATTTATCTTTAGAAAATGAAGGG - Intergenic
1159332179 18:67010265-67010287 TTACATTTTTAGAAACTGGAAGG - Intergenic
1159466879 18:68795182-68795204 TTCTAGATTGAGAGACTGGATGG + Intronic
1160197198 18:76765509-76765531 TTTTATGTTGAGAGAATGAAGGG - Intergenic
1161178862 19:2866191-2866213 TTTTTACTTGAGAAACTGTGAGG + Intergenic
924980741 2:218481-218503 TTTTAATTTGAGAATCTTGAGGG - Exonic
925621569 2:5798678-5798700 TTTTTTCTTCAGAAATTTGAAGG + Intergenic
925996615 2:9298674-9298696 TTTAAACTGGAGAAACTGCATGG + Intronic
926259949 2:11250647-11250669 TTTTAGCTAGAGCAACTAGAAGG - Intronic
926450198 2:12994273-12994295 ATTTGTTTTAAGAAACTGGATGG - Intergenic
926585370 2:14680136-14680158 TTTTATACAGAGAAAATGGAGGG + Intergenic
926849475 2:17179148-17179170 TTTGATACTGGGAAACTGGAAGG - Intergenic
927122312 2:19977398-19977420 TTTTAGCTTGGGCAGCTGGATGG - Intronic
927631908 2:24781639-24781661 TTTTGTCCTGGGCAACTGGAAGG + Intergenic
927706293 2:25298482-25298504 TCTTGTCCTCAGAAACTGGACGG + Intronic
927756783 2:25714824-25714846 TTTCAGCTTGAGAGCCTGGAAGG + Intergenic
928039104 2:27855943-27855965 TTTTATCTTGATAAATTTCATGG + Intronic
928102143 2:28445115-28445137 TTTCATCTTGAGCAACTCAACGG + Intergenic
928453475 2:31399123-31399145 TTTTGTCTTGAGCAATTGGGTGG + Intronic
928504858 2:31940481-31940503 TTTTGTCCTGTGAAACTAGAAGG - Intronic
928975281 2:37080545-37080567 TTTTCCCTTGAGCAACTAGAAGG + Intronic
929029141 2:37634730-37634752 TTTTGTCCTGAGAAGCTGGCTGG + Intergenic
930875431 2:56210307-56210329 TTTTCTCTTGGTAAACTGGAAGG + Intronic
931128242 2:59301899-59301921 TTTTATCATCAGAGTCTGGAGGG - Intergenic
931138881 2:59435424-59435446 ATTTATCTTGATAAACTGTTTGG - Intergenic
931644692 2:64411346-64411368 TGTTTCCTTGAGAAAATGGAAGG + Intergenic
932426119 2:71636495-71636517 TTTTGGCTTGAGCATCTGGAAGG + Intronic
933246441 2:79980059-79980081 TTTTCCCTTTAAAAACTGGAAGG - Intronic
933358451 2:81245433-81245455 TTTTAACTTGAGCAACTAGATGG + Intergenic
933434692 2:82233650-82233672 TTTTATCTAAAAAAACTAGAAGG + Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
934869647 2:97851352-97851374 TTTTGTCCTGAGCAACTAGAAGG - Intronic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
937636762 2:124164872-124164894 TTTTGTCTTAAGCTACTGGATGG + Intronic
939024919 2:137000828-137000850 TTTTATTTTTAGTAACTAGAAGG + Intronic
939700366 2:145384245-145384267 TTTTGACCTGAGCAACTGGAAGG - Intergenic
940012479 2:149069545-149069567 ATTTATGTTGAGAAGCTGGTTGG + Intronic
940116203 2:150211053-150211075 CTTAAACTTGAGAACCTGGAGGG + Intergenic
940438409 2:153683457-153683479 TTTTATCTTGAGAAAGTTCAAGG + Intergenic
942192230 2:173481616-173481638 CTTTGTCCTGAGCAACTGGAAGG + Intergenic
942330507 2:174818666-174818688 TATTAACTTGAGAAATTGGAAGG - Intronic
942631298 2:177952428-177952450 TTTTCTCTTGTGAATCTTGAGGG + Intronic
942820270 2:180105501-180105523 TTTTATATAGAGAGACTGGGAGG + Intergenic
943296788 2:186150544-186150566 TTTTAGCCTGAGAAACTGAAGGG - Intergenic
943748321 2:191485470-191485492 TTATATCTTGAGAAGCAGAAGGG - Intergenic
943800621 2:192053125-192053147 TTTTATTTTGAGAAAACAGATGG - Intronic
944006841 2:194920012-194920034 TTTTATCTTGTGAGACGGGAGGG - Intergenic
944517865 2:200530329-200530351 TTTTGGCCTGAGCAACTGGAAGG + Intronic
944542834 2:200769810-200769832 TGTTTGCTAGAGAAACTGGAAGG + Intergenic
945465286 2:210162360-210162382 TTTTAGCTTGAGCAACTGGGTGG + Intronic
945711494 2:213302464-213302486 TTCTGTCTTGAGGAACTGAACGG - Intronic
946305397 2:218854162-218854184 TTTTAACCTGATTAACTGGATGG - Intergenic
946661161 2:222001302-222001324 TTTTCTCTTGAGATTTTGGATGG + Intergenic
947321628 2:228925711-228925733 TTTTTGCCTGAGCAACTGGAAGG - Intronic
947755800 2:232564042-232564064 TTTTATTTTGTCAAACTAGATGG + Intronic
947994828 2:234518364-234518386 ATGTTTCTAGAGAAACTGGAAGG - Intergenic
1168981764 20:2010082-2010104 TTCTGTCTTGAGCACCTGGATGG + Intergenic
1169430841 20:5534701-5534723 ATTTGACCTGAGAAACTGGAAGG + Intergenic
1169636843 20:7701709-7701731 TTTCATCTTAAGACACTGGGTGG + Intergenic
1170654298 20:18271692-18271714 TTTTTTTTTAAGAAACAGGAAGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172264205 20:33596871-33596893 TTTTAGCCTAAGCAACTGGAAGG - Intronic
1173836641 20:46130334-46130356 TTTTATCCTGAGATACTGCTTGG - Intergenic
1174274903 20:49396620-49396642 TTTCATCCTGAGCAACTGGGAGG + Intronic
1175647460 20:60687001-60687023 TTTTATTTTGAGAAACTCACAGG - Intergenic
1180754473 22:18151134-18151156 ATTCATATTGAGAAATTGGAAGG + Intronic
1181667361 22:24407387-24407409 GTTTATCTTGAGGAAGCGGAGGG + Intronic
1181961202 22:26622974-26622996 GATTGTCTTGAGAAATTGGAAGG + Intronic
1182949131 22:34355049-34355071 TTTGCTGTTAAGAAACTGGAAGG - Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1183879747 22:40817559-40817581 TTTTGGCTTCAGTAACTGGAGGG - Intronic
1183987726 22:41578567-41578589 TTTTGGCCTGAGAAACTGGGTGG + Intronic
1184371642 22:44085989-44086011 TTTCATCTTGAGAAATGGGCTGG + Intronic
1184436680 22:44482980-44483002 TTTCATCTTAAGAAACTTGAGGG + Intergenic
1184537984 22:45100379-45100401 TTTTGTCCTGAGAATGTGGAAGG + Intergenic
1184673151 22:46026188-46026210 GTATATCTGGAGAAGCTGGAAGG + Intergenic
949139923 3:619855-619877 TTTTCTCTGGAGAATCTTGACGG + Intergenic
949644705 3:6079250-6079272 TTTTATCTTATGAAATGGGAAGG - Intergenic
950354285 3:12391534-12391556 TTTTGGCTTGAGAAACTGGAAGG + Intronic
950690841 3:14655962-14655984 TTTTATTTTGAAAAACTTCAAGG + Intronic
951046880 3:18049868-18049890 TTTCATTTTGAGAAACTGAAAGG - Intronic
951107443 3:18761558-18761580 TGTTTTCTTGACAAAATGGAAGG + Intergenic
951118233 3:18891034-18891056 TTTTTTCATGAGAAATTGAAAGG + Intergenic
951181114 3:19660300-19660322 TTTTTTCTGGACATACTGGATGG - Intergenic
951623783 3:24636864-24636886 ATTAAACATGAGAAACTGGATGG - Intergenic
951791355 3:26488211-26488233 CTTTAAATTAAGAAACTGGAGGG + Intergenic
951935786 3:28021763-28021785 TTTTAGCTTGAGCAACTGGATGG - Intergenic
951950676 3:28197087-28197109 TTTTGGCTTGAGCAACTGGAAGG + Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953151693 3:40330910-40330932 TTTTATCTTTGGAAATTGGGTGG + Intergenic
954154515 3:48678053-48678075 ATTTATCTTGAGCAGCTAGATGG - Intronic
956084086 3:65591283-65591305 TTTTAACATGAACAACTGGAAGG - Intronic
956692153 3:71888461-71888483 TTTTGGCCTGAGAAACTGGAAGG - Intergenic
957725392 3:84058466-84058488 TTTTAGCTTGAGAAACTAAATGG + Intergenic
957846913 3:85748767-85748789 TTTTATCTTTCTAAACTGTAAGG + Intronic
958017492 3:87957962-87957984 TTTTATCCTAATAAACTAGAAGG - Intergenic
958568628 3:95849598-95849620 TTTTTTTTTAAGAAACTGTATGG + Intergenic
959055994 3:101568226-101568248 TGTTGACTAGAGAAACTGGAAGG + Intergenic
959803741 3:110526455-110526477 TTTTAACTTCAGAAACAGGTAGG - Intergenic
959896258 3:111610267-111610289 TTTTGCCTTGGCAAACTGGAGGG + Intronic
960107323 3:113812290-113812312 TTTTACTTTGAGAAAGTGAATGG + Intergenic
960280987 3:115781309-115781331 TTTTTGCTTGAGAAACCGGGTGG + Intergenic
960356010 3:116654465-116654487 TTTTCGCCTGGGAAACTGGAAGG - Intronic
960476247 3:118132332-118132354 TTATATATTGAAAAACTGGCTGG - Intergenic
960608580 3:119533323-119533345 TTTTCCCTTGATAAACTGGAAGG - Intronic
962034162 3:131633082-131633104 TCTTAGCCTGAGCAACTGGAAGG - Intronic
963278286 3:143355115-143355137 TTTGATTTTGAGTAAATGGATGG - Intronic
964013733 3:151921482-151921504 ATTTACCATGAGAACCTGGAGGG + Intergenic
964887445 3:161500888-161500910 GTTGATCTTGTGAAACTGGAGGG + Intronic
965036316 3:163443275-163443297 TCTTGTCTTGAGAACCTTGAAGG - Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965900528 3:173635204-173635226 TTGTCTCTTAAGAAACTGTAGGG - Intronic
966394693 3:179490566-179490588 TAAAATCTTGAGAACCTGGAGGG + Intergenic
966441803 3:179953585-179953607 TTTTGTTTTGAGAAGCAGGAGGG + Intronic
966786576 3:183628481-183628503 TGATTTCTTAAGAAACTGGATGG + Intergenic
966950919 3:184816941-184816963 TATTATCTTCAGCAACGGGAAGG - Intronic
967065604 3:185912406-185912428 TTTTATGTAAAGAAACTGCAGGG - Intergenic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
967673907 3:192272899-192272921 TTTTTTCTTCTGAAACTGGAAGG - Intronic
968153058 3:196354387-196354409 TTTTATCAAGAGAAGCTAGAAGG + Exonic
968297293 3:197586516-197586538 TTTTGTCCTGAGTAACTGGAAGG + Intergenic
969090175 4:4688196-4688218 TTTCATCTTGAGGAACTCAAAGG + Intergenic
969137795 4:5044503-5044525 TTTTGGCTTGAACAACTGGAAGG - Intergenic
970230262 4:13902626-13902648 ATTTATCTTGAGAAACTGTTGGG - Intergenic
970406022 4:15765232-15765254 TTTTGGCTTGAGCAACTGGAAGG - Intergenic
970500827 4:16675090-16675112 TTTTATTTTGAGATAATGGTAGG + Intronic
970504538 4:16714157-16714179 GTTTATCCTAAGAAACTGGAGGG + Intronic
970811486 4:20099592-20099614 GTTTGGCCTGAGAAACTGGAGGG + Intergenic
971848997 4:31959270-31959292 TTTTATCTTGAGAAATGTTATGG - Intergenic
973866294 4:55117200-55117222 TTTTATTTTGAGAGGCTGGGTGG - Intronic
974613434 4:64247927-64247949 TTTTGGCTTGAGAAACTAGATGG - Intergenic
974920200 4:68229779-68229801 TTAAATGTTCAGAAACTGGATGG - Intronic
975453191 4:74554383-74554405 TTTTGTCTTGAAAAATTGGCTGG + Intergenic
975598302 4:76071775-76071797 TTTTAGCTTGAATAGCTGGAAGG - Intronic
975621924 4:76305205-76305227 TGTGATCTGGAGCAACTGGAGGG + Intronic
976162199 4:82214350-82214372 TATTAGCTTGAGAAACTGCAAGG - Intergenic
976764893 4:88589940-88589962 TTTCATCTTGAGGAAAAGGATGG - Intronic
977828348 4:101559807-101559829 TTTTGTTTTGAGAGACTTGATGG - Intronic
978141720 4:105325335-105325357 TTGTTTCTTGAGAAAGTAGATGG - Intergenic
978165355 4:105600799-105600821 TTTTTGCCTGAGCAACTGGAAGG - Intronic
978632995 4:110768746-110768768 TTTTATCTTGATCAAATGGTAGG - Intergenic
978998406 4:115184728-115184750 TTCTAGCTTGAGAAACTGAGAGG + Intergenic
979095038 4:116537335-116537357 TTTTAGCTTGAACAACTGGGTGG - Intergenic
979454961 4:120916757-120916779 TTTTAGCCTGAGGAATTGGAAGG - Intronic
979958035 4:126979960-126979982 TATTGGCTTGAGCAACTGGAAGG + Intergenic
980299416 4:130967930-130967952 TTTTATGTTGAACAACTAGAAGG - Intergenic
980815754 4:137943486-137943508 TATTATCTTTAGTAACTGTATGG - Intergenic
981450609 4:144893104-144893126 TTTTATATTGATAATCTGGTAGG + Intergenic
981500908 4:145450333-145450355 TTTGATCTTGATGAATTGGAAGG + Intergenic
981562099 4:146059164-146059186 TTTTATCCTGAACAAATGGAAGG - Intergenic
982675917 4:158375597-158375619 GTTTATCTTTAAAAAATGGATGG - Intronic
983200146 4:164852573-164852595 TCCTATCTTGAAAAAATGGAAGG + Intergenic
986372231 5:7091697-7091719 TTTTGGCTTGAGCCACTGGATGG + Intergenic
986387673 5:7250758-7250780 ATTTATCTTGCAAAACAGGAAGG + Intergenic
986986550 5:13506873-13506895 TTTGGGCTTGAGCAACTGGATGG + Intergenic
987080100 5:14418503-14418525 TTTTAGCTTGAGTGACTTGATGG + Intronic
987166668 5:15205066-15205088 TCTTATCCTGAGAAGCTGGATGG - Intergenic
987611501 5:20210097-20210119 ATCAATATTGAGAAACTGGATGG - Intronic
988906689 5:35797939-35797961 TTTTGACCTGAGCAACTGGAAGG - Intronic
989151128 5:38300930-38300952 TTTTAGCCTGAGCAACTAGAAGG + Intronic
989217037 5:38916319-38916341 ATTCATCTTTAGAAAATGGATGG - Intronic
989250183 5:39304713-39304735 TTCTTTCTTGATAAACTGGAAGG - Intronic
989288333 5:39730380-39730402 TTTTATCTCTAGAAACTGACTGG + Intergenic
990679420 5:58224390-58224412 TTTTATCTGGGAAGACTGGATGG - Intergenic
990688862 5:58339716-58339738 TTTAATTTTGAGAAAATGGTTGG - Intergenic
990900856 5:60747371-60747393 TTTTAGCCTGAATAACTGGAAGG + Intergenic
990974758 5:61549580-61549602 TTTAAACTTGAGCACCTGGAAGG + Intergenic
991238944 5:64434005-64434027 TTTTGACTTGAGTAACTGAAAGG + Intergenic
991325782 5:65430497-65430519 TATTCTTTGGAGAAACTGGATGG + Intronic
991392023 5:66154911-66154933 TTTCATACTGAGAAACTGCATGG + Intronic
991619399 5:68529962-68529984 TTTTGTCTTTTGAAACTGGGTGG - Intergenic
992353000 5:75949971-75949993 CTTTAGCTAGAGCAACTGGAAGG + Intergenic
992610897 5:78507656-78507678 TCTTATCCTGAGGAACTTGATGG - Intronic
992879984 5:81098186-81098208 TTTTGGCCTGAGCAACTGGAAGG + Intronic
993187327 5:84636289-84636311 TTTTTTCTTGATAAAGTTGAAGG - Intergenic
993540620 5:89146255-89146277 CATTATCTTGAGAATCTTGAGGG + Intergenic
994338400 5:98597105-98597127 ATTCATCTGGATAAACTGGATGG + Intergenic
994397566 5:99238061-99238083 TTTTGGCTTGAACAACTGGAAGG + Intergenic
994527745 5:100927805-100927827 TTTAATCATCAGAAACAGGATGG - Intergenic
994680528 5:102881003-102881025 TATAATCTTGAGGAAATGGATGG + Intronic
994711067 5:103264739-103264761 CTTTAGCTTGAGAAACTGGAAGG - Intronic
995228924 5:109736058-109736080 GTTTGTCTTGAGTAACTGGAGGG - Intronic
995625685 5:114073987-114074009 TTCCATCTTGAGAAACTTGAAGG - Intergenic
995970737 5:117967459-117967481 TTTTAACTTAAGAAACAGGTTGG - Intergenic
995976381 5:118040657-118040679 TTTCATCTTGGGAAACTGAATGG - Intergenic
996392903 5:122981965-122981987 TTTTCTCTTGACTATCTGGAAGG - Intronic
996650188 5:125866447-125866469 CTTGATCTAGAGCAACTGGAAGG - Intergenic
997437957 5:133888728-133888750 TTTTGTCCTGAGCAACTGGAAGG - Intergenic
998468967 5:142368384-142368406 TTTTATATTGATAAGCTGCAGGG - Intergenic
998516354 5:142758082-142758104 TTTTGTCTTGAGCAACTACAAGG + Intergenic
999302963 5:150502382-150502404 TTCTGGCTTGAGGAACTGGAAGG + Intronic
999499664 5:152134141-152134163 ATTTTTCTTGAGAAACTGTATGG + Intergenic
999580640 5:153034857-153034879 TGTTATCATGGCAAACTGGAGGG + Intergenic
1000073439 5:157762748-157762770 TTTTAGGTTGAGATACTGGCGGG + Intergenic
1000429619 5:161135718-161135740 TTTTAATATGAGAAACTGCAAGG + Intergenic
1000552250 5:162681501-162681523 TTTTATCCTGAGCAAGTGGGTGG + Intergenic
1002273634 5:178089326-178089348 TTTTGGCATGAGTAACTGGACGG - Intergenic
1002473179 5:179449551-179449573 TCTTATCTTGTGAGACTGGGAGG + Intergenic
1002481044 5:179501102-179501124 TCTTATCTTGTGAGACTGGAAGG - Intergenic
1002717589 5:181237782-181237804 TTTTAACTTGAGAATCTTGAGGG - Intronic
1003130652 6:3392708-3392730 TTTTGGCTTGAGCAACTGCATGG + Intronic
1004446871 6:15708495-15708517 TTTTATTTTGAGGGTCTGGAAGG - Intergenic
1004470773 6:15927200-15927222 TCTTGGCTTGAGAAACTGCAAGG + Intergenic
1005039705 6:21589577-21589599 TGTTTTCTTGAGAAAATCGAAGG + Intergenic
1006329560 6:33380546-33380568 TTTTGGCTTGAGCAACTGGGTGG - Intergenic
1006339595 6:33439463-33439485 GATTAGCTTTAGAAACTGGAAGG + Intronic
1007251157 6:40496063-40496085 TTTTGGCTTGAGCATCTGGATGG - Intronic
1007328508 6:41083502-41083524 TTTTAGCTTGAGAGACTGTAGGG + Intronic
1008721877 6:54364022-54364044 TTTTATCTTTAGGAGCTAGAAGG + Intronic
1009330058 6:62407647-62407669 TTATATTTTGAAAAACTAGAAGG + Intergenic
1009445239 6:63734668-63734690 TTTTGTCCTGAGAAACTAGAAGG + Intronic
1009498859 6:64385803-64385825 TTTTTTCTCCAGAAACTGGTGGG + Intronic
1009553082 6:65125213-65125235 TTTTATCTTGAATAAATGAAGGG - Intronic
1009566720 6:65319918-65319940 ATTTTTCTTGAAAAATTGGATGG - Intronic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1010171934 6:72985307-72985329 TTAAATATTGAGAAAATGGAAGG + Intronic
1010275256 6:73961700-73961722 GTTTATCTTGAGAACATGTACGG + Intergenic
1010437803 6:75855320-75855342 TTTTTCCTTGACAAACTGCAAGG - Intronic
1010467727 6:76188803-76188825 TTTTATCATGATAAACATGATGG - Intergenic
1010558635 6:77318402-77318424 TTTTATCTTCAAAAACAGGCAGG + Intergenic
1011989661 6:93498480-93498502 TTTTATCCTGGGAAACAGAAGGG - Intergenic
1012182190 6:96168043-96168065 TTATAGCTTGAGCAACTGAAAGG + Intronic
1012396986 6:98809928-98809950 TTTTAGCCTGAGCAACTGCAAGG - Intergenic
1012959484 6:105607676-105607698 TATTTTCTTGAGAAAATGAATGG + Intergenic
1013055761 6:106581435-106581457 TTTTATCCTGGGAAATTAGAAGG - Intronic
1013214974 6:108018997-108019019 TTTCAGTTTGAGCAACTGGATGG + Intergenic
1013655892 6:112245982-112246004 TTTTATCATGAGAAACTTGGGGG - Intronic
1014512502 6:122341578-122341600 TTTCATCTGAAGAAACTGTATGG - Intergenic
1014909882 6:127079003-127079025 TTTTGTCCTGAGTAACTAGAAGG - Intergenic
1015065021 6:129014054-129014076 TTTTGTCTTGAGCAACTGCATGG + Intronic
1015103437 6:129507957-129507979 TCTCATCTCCAGAAACTGGAAGG - Intronic
1015111386 6:129595849-129595871 TTTTGGCCTGAGAAATTGGAAGG - Intronic
1015565441 6:134565214-134565236 TTTTATTTTGAGAAACTAAAAGG + Intergenic
1015980226 6:138831076-138831098 TTCTAACTTTTGAAACTGGATGG - Intronic
1016079866 6:139843044-139843066 TTTTATCTTGGATAACTGGAAGG - Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016293516 6:142549691-142549713 TAGTCTCTTGAGAGACTGGAAGG + Intergenic
1016806712 6:148219162-148219184 TTTTATCTTGCGAAACTATTTGG + Intergenic
1016895070 6:149043412-149043434 TTTTTTTCTGATAAACTGGATGG - Intronic
1017936470 6:159010051-159010073 TTTTATTTTTCAAAACTGGAAGG - Intergenic
1018222353 6:161593637-161593659 TTTTATCCTGAGGAACCGGCTGG + Intronic
1018299786 6:162388991-162389013 TTTTTTCTGGAGGAACTGAAAGG - Intronic
1020909525 7:14111342-14111364 TTTTGGCATGAGCAACTGGAAGG - Intergenic
1021244714 7:18246992-18247014 TTCTAACGTGAGCAACTGGAAGG + Intronic
1021442813 7:20698064-20698086 TTTACTCTTGTTAAACTGGATGG - Intronic
1021762849 7:23918165-23918187 TTTTAGCTTGAATAACTGGATGG - Intergenic
1022188783 7:27996890-27996912 TTTTATAATGAGAAAATTGAAGG + Intronic
1022240956 7:28512070-28512092 ATTTGGCTTGAGCAACTGGAAGG + Intronic
1023244592 7:38187864-38187886 TTAGAGCTTGAGAAACTGGAAGG - Intronic
1024086092 7:45892779-45892801 TTTTATGATGAGAACCAGGAGGG + Intronic
1024289041 7:47787021-47787043 TTGTATCTTTATAAACTAGAAGG - Intronic
1024985672 7:55191494-55191516 TTAAAACTTGAGGAACTGGATGG + Intronic
1026346216 7:69476367-69476389 TTTAATCTTAAGTAACTGAAAGG + Intergenic
1026418579 7:70209249-70209271 GTTTAGCTTGAGCAGCTGGATGG + Intronic
1028158022 7:87454188-87454210 ATTTCTATTGAGAAACTAGAAGG + Intronic
1028620747 7:92825550-92825572 TTCCATCTTGACAAACTGGTAGG - Intronic
1028830986 7:95326295-95326317 TTTGGACTTGAGCAACTGGATGG - Intergenic
1029601644 7:101567144-101567166 TTACATCCTGAGAAACTGGAGGG - Intergenic
1030226031 7:107152089-107152111 TTTTGGCCTGAGACACTGGAAGG - Intronic
1030544122 7:110871118-110871140 TTTTGTCTTGAGTAACTGGGTGG + Intronic
1030844952 7:114397999-114398021 TTCTCTCTTGAGAAATTCGATGG + Intronic
1031147435 7:118012503-118012525 TTTTTACTTGAGGAACTTGAGGG - Intergenic
1031467207 7:122127129-122127151 TTTTATCTTGAGCTACTCGAAGG - Intronic
1031523877 7:122800287-122800309 TTTTATTTTGAGAAATCTGAAGG - Intronic
1031547634 7:123069135-123069157 TTTAATTTTGAAAAGCTGGAGGG - Intergenic
1031758503 7:125679457-125679479 ATTTATCTTATGAAACTGAAGGG - Intergenic
1032066875 7:128778411-128778433 TTTCACCTTGAGAAGCTGAAAGG + Intergenic
1032380442 7:131474274-131474296 TTTTGGCCTGAAAAACTGGAAGG + Intronic
1032582082 7:133112793-133112815 TTTGGTCTTGGGCAACTGGATGG - Intergenic
1035711950 8:1724253-1724275 TTTAATTATGAGAAACTGGAAGG + Intergenic
1035775928 8:2188239-2188261 TCATAGCTTGAGAAAGTGGAGGG - Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1037448285 8:18990242-18990264 TTTTATCCTGTGAACATGGAAGG - Intronic
1037551041 8:19971707-19971729 TTTCCTCCTGAGCAACTGGAAGG - Intergenic
1038056581 8:23863994-23864016 TCTTGACTTGAGAAAATGGAGGG + Intergenic
1038531707 8:28323207-28323229 TTTTATCTTTATAAACAGCAAGG + Intronic
1039790050 8:40868467-40868489 TTGTATCCTGAGAAACTGCTGGG - Intronic
1040871401 8:52103280-52103302 TTTAATGTTGAGAAACAAGATGG - Intergenic
1040949988 8:52928511-52928533 TTTTTTCTTGGGAAAAGGGATGG - Intergenic
1041025324 8:53679618-53679640 TGATATCTTCAGAAACTAGAGGG + Intergenic
1041083468 8:54235246-54235268 TTCTAATTTGGGAAACTGGATGG + Intergenic
1041400651 8:57440816-57440838 AGGTATCTTGAGATACTGGATGG + Intergenic
1041616781 8:59916645-59916667 TTTTAGTTGGAGAATCTGGAGGG + Intergenic
1041825420 8:62090387-62090409 CTTTATCATGAGAGACTGGAGGG + Intergenic
1043772737 8:84225087-84225109 ATCTATCTTGAGCAACTGGATGG - Intronic
1043877585 8:85503501-85503523 GTTTGGCTTGAGAAACTGGATGG - Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1044731828 8:95234845-95234867 TTTTCTCTTGGGATAATGGAGGG + Intergenic
1045707438 8:104942389-104942411 CTTTATCTTGTAAAACTGGGAGG + Intronic
1046645678 8:116782918-116782940 TTTTGGCTTGAGCAACTGGAAGG + Intronic
1047092618 8:121590537-121590559 TTTTGTTATGAGCAACTGGAAGG - Intergenic
1047223378 8:122937045-122937067 CTTTCTCTAGAAAAACTGGATGG + Intronic
1050192018 9:3036270-3036292 TTTGATCTTGGGACACTGGGTGG - Intergenic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1051160384 9:14200964-14200986 TTTCAGCTTGGGAAACTGAATGG - Intronic
1051412433 9:16804549-16804571 TTTTATTTTGAAAAATTGAAAGG - Intronic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1052221931 9:26034802-26034824 TTTTTTTTTGAGAAACTGCGTGG - Intergenic
1052646948 9:31248941-31248963 TTTTATTATGAGTGACTGGATGG + Intergenic
1053341770 9:37342253-37342275 TTTTGGCCTAAGAAACTGGAAGG + Intronic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055295948 9:74833804-74833826 TTTTGACTTGAGCAACTGCAAGG + Intronic
1055418036 9:76105580-76105602 TTTTATGTTAAGAAACTGTCTGG - Intronic
1055493067 9:76825961-76825983 TTCTATTTTGAGAAGATGGAAGG - Intronic
1056258243 9:84822510-84822532 TTTTATCCTGAGAAACTCTTGGG + Intronic
1057409872 9:94808674-94808696 TTTTATGGTGAGAAACAGGGAGG - Intronic
1058134149 9:101288631-101288653 TTTTTACTTGAGCAACTGGGTGG - Intronic
1058802693 9:108560216-108560238 TTTTATTTTGTTAAATTGGAGGG - Intergenic
1058957940 9:109966629-109966651 TTTTATCTTTTAAATCTGGATGG + Intronic
1059162525 9:112048763-112048785 TTTAATCTTGAAAAACAGGTGGG + Intronic
1059592043 9:115672231-115672253 TTTTGTTTTGAGCAATTGGATGG + Intergenic
1059599356 9:115759617-115759639 TTTTTATTTGAGAAACAGGACGG + Intergenic
1059826806 9:118039109-118039131 TATTCTCTTGAAAAACTGGAAGG - Intergenic
1060233583 9:121843522-121843544 CTTTTTCTTGAGAACCTGGTGGG - Intronic
1185701097 X:2231015-2231037 TCTTAGCTTGAGTCACTGGAAGG + Intronic
1186682056 X:11885427-11885449 TTTCATCTTGCAAAACTGAAAGG - Intergenic
1186874368 X:13802785-13802807 AAATATCTTGAGTAACTGGAAGG + Intronic
1186912221 X:14180627-14180649 TTTTATCCCAAGAAACTGGCAGG + Intergenic
1187020134 X:15373048-15373070 TTTTATTTTGAAAAATTGGTTGG - Intronic
1187736223 X:22306510-22306532 TTTTATTTTGAGACAATGAAGGG + Intergenic
1187901478 X:24030307-24030329 TTCTGTCCTGAGCAACTGGAAGG + Intergenic
1188157934 X:26764455-26764477 TTCTAGCTTGAGCAACTGAATGG - Intergenic
1188528639 X:31113313-31113335 TTTTGACCTGAGCAACTGGAAGG + Intronic
1188681126 X:33006890-33006912 TTTTAGCTTGAGCAAAAGGAAGG - Intronic
1189162011 X:38819031-38819053 TTTAAGCCTGAGCAACTGGAAGG - Intergenic
1189311055 X:40017897-40017919 CTTTATATTGAGAAGCGGGAGGG - Intergenic
1189752642 X:44238167-44238189 TTTGGGCTTGAGCAACTGGAAGG - Intronic
1190335475 X:49259186-49259208 TTTTAGCTTGAGCAGCTGGAAGG + Intronic
1190842051 X:54154300-54154322 TTTTAGCCTGAGAAAATGGAAGG + Intronic
1191677327 X:63805186-63805208 TTTTATTCTGAGCATCTGGAAGG + Intergenic
1191764980 X:64688298-64688320 TTTTATCTTGTGAAATTGGGTGG - Intergenic
1192622736 X:72695620-72695642 TTTTAAATTGAGAACCGGGAAGG - Intronic
1193020073 X:76781996-76782018 TTTTATAGTGAAAAAATGGAAGG - Intergenic
1193841743 X:86415721-86415743 TTTTATCTGGAGAAAATACATGG + Intronic
1194542946 X:95197167-95197189 CTTAATGTTGAGAAACTAGATGG - Intergenic
1194764690 X:97836313-97836335 ATCTAGCTTGAGCAACTGGATGG - Intergenic
1195060061 X:101185621-101185643 TGTTAATTTTAGAAACTGGAAGG + Intergenic
1195511246 X:105717729-105717751 TTTTAGCTTTAGAAACTCAAAGG - Intronic
1195915662 X:109932725-109932747 TTTTGGCTTGAGCAACTGGAAGG + Intergenic
1196231057 X:113221944-113221966 TTTTGACTTGAGCAACTGGAGGG + Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1196826789 X:119747091-119747113 CTTTATCTTGAAGAACTGGATGG - Intergenic
1197288135 X:124620673-124620695 TTCTATCTAGAAAAACTAGATGG + Intronic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197698132 X:129572983-129573005 TTTTATTTTCACAACCTGGAAGG - Intronic
1197809948 X:130432407-130432429 TTTTGACTTGAGTAACTGAATGG - Intergenic
1197821221 X:130542717-130542739 TTTCAGCTTGAGGAACTGAAAGG + Intergenic
1198413411 X:136394545-136394567 TTTTATCCTGAGAGACTTGGAGG - Intronic
1198805392 X:140489249-140489271 ATTTGTCTTGAGAAACTACATGG + Intergenic
1199276698 X:145952140-145952162 TTTTATCATGAAAAAGTGGTAGG - Intergenic
1200322585 X:155205417-155205439 TTTTGGCCTGAGCAACTGGAAGG - Intronic
1201679297 Y:16624450-16624472 TTATAACTTTAGAAACTGGCTGG - Intergenic