ID: 1100681651

View in Genome Browser
Species Human (GRCh38)
Location 12:96930246-96930268
Sequence CACTCTCACATGCTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100681651 Original CRISPR CACTCTCACATGCTGTGTTG GGG Intronic
900856860 1:5192832-5192854 CACTCACACATGCTATATTTTGG + Intergenic
901565780 1:10113696-10113718 CACGCTCACATGCTGGCTGGGGG + Intronic
902645370 1:17794045-17794067 CCCTCTCACATTCTGTTATGTGG + Intronic
903829530 1:26166132-26166154 GCCTCTCTCATGCTGTGTGGGGG - Intergenic
904380595 1:30107998-30108020 CACACTCACATGGTGTATTGTGG - Intergenic
905513916 1:38546943-38546965 CACTCTCTCCTCCGGTGTTGTGG + Intergenic
907803774 1:57798008-57798030 CTCTCTCACATGGTGTTGTGAGG - Intronic
909418354 1:75433380-75433402 CAATATCAAATGCTGTGTAGAGG - Intronic
910376949 1:86582850-86582872 CACTTACACATGCTGTACTGGGG - Intergenic
912183767 1:107249986-107250008 CAGTCTCCCATGCAGTGTAGGGG + Intronic
915709454 1:157880794-157880816 CCCTCCCACAGCCTGTGTTGTGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919518447 1:198556580-198556602 CAATCTCATGTGCTGTGCTGTGG + Intergenic
920869765 1:209784320-209784342 CACTATAACATGCTCTGGTGTGG - Intronic
922767609 1:228164011-228164033 CCCTCTGCCCTGCTGTGTTGGGG + Intergenic
923333029 1:232943284-232943306 CACTCACACATACTGTGTTGTGG - Intergenic
924029162 1:239869161-239869183 CACCTTCACCTGCTGTTTTGGGG - Intronic
1062868952 10:881820-881842 CAATCTTGCATGCTGTGTTAGGG + Intronic
1066525980 10:36280303-36280325 AGCCCTCACATGCTGTTTTGTGG - Intergenic
1067051795 10:43025659-43025681 CAGTCTCTCTTGATGTGTTGTGG + Intergenic
1069187628 10:65445468-65445490 CACTCTCATATGCATTGATGGGG - Intergenic
1069854820 10:71434288-71434310 CTCACTCACCTGCTCTGTTGGGG + Intronic
1070720018 10:78749890-78749912 CACTTTCATATTCTCTGTTGGGG + Intergenic
1074593262 10:114835305-114835327 TGGTCTCACATGCTGTGTTATGG + Intronic
1075588490 10:123674803-123674825 CTCTCTCACATGCAGTGTGCGGG + Exonic
1078125684 11:8560219-8560241 CACTCTCATATCCTTTCTTGAGG - Intronic
1079613283 11:22459642-22459664 CACTCTCAGTAGCTGTTTTGAGG + Intergenic
1081789024 11:45769707-45769729 CACTCTCAGAGGCTGAGATGGGG - Intergenic
1084319022 11:68363259-68363281 CACCATCACAGGCTGTGTTTGGG + Intronic
1085456386 11:76667792-76667814 CCCTCTCACATTCTGGGTTCTGG + Intronic
1086884643 11:92191005-92191027 CACTTGCACCTGCTGAGTTGGGG + Intergenic
1087617605 11:100506358-100506380 CATTCTCTCAGGCTGTGGTGGGG + Intergenic
1089649381 11:119902517-119902539 CAATCTCAAAGGCTGTGCTGAGG - Intergenic
1090353691 11:126124545-126124567 CACTCTCCCTTGCTGTATTATGG + Intergenic
1090529463 11:127575848-127575870 CACTCACACATTCTCTTTTGGGG + Intergenic
1091608138 12:1975794-1975816 CAATCTGACATGCTGAGGTGAGG - Intronic
1092419387 12:8317445-8317467 CACTCTAAAATGCTGTCCTGGGG - Intergenic
1092713251 12:11360240-11360262 CACTCTGACATTGTGTGATGAGG - Intronic
1095186555 12:39207694-39207716 CAGTCTCTCATACTTTGTTGTGG + Intergenic
1095548965 12:43410210-43410232 CAGTCTCTCATCCTGTGTTTTGG - Intronic
1097615113 12:61875189-61875211 CATTCTCACGTGCCCTGTTGAGG + Intronic
1098285093 12:68898648-68898670 TCATCTCACATGCTGTGTTCAGG - Intronic
1099099542 12:78421124-78421146 CACTCTCAGAAGCAGTTTTGTGG - Intergenic
1100479473 12:94964280-94964302 CACTCTCACATTTTCTCTTGTGG - Intronic
1100681651 12:96930246-96930268 CACTCTCACATGCTGTGTTGGGG + Intronic
1102762841 12:115403980-115404002 AACTCTTACATGGTGTTTTGAGG - Intergenic
1112412019 13:99172810-99172832 CGTTCTCAAACGCTGTGTTGGGG + Intergenic
1113376908 13:109772532-109772554 CAATCTCACCTGCTGTTTGGTGG + Intronic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1117979256 14:61325989-61326011 AACTCTCATATGCTATGGTGAGG + Intronic
1121246275 14:92463070-92463092 GAATCTCACATGCTGTCTTCAGG + Intronic
1121537614 14:94701644-94701666 CACACTGCCATGCTCTGTTGGGG - Intergenic
1122539824 14:102491888-102491910 CACCCACACATGCTGGGTTTTGG - Intronic
1126315105 15:47361709-47361731 CCCTCGCACATGCTCTGGTGGGG + Intronic
1127858016 15:62968255-62968277 GCCTCTCACATGCGGTATTGGGG + Intergenic
1128541228 15:68535011-68535033 AACTCTCACATGCTGTGGGAGGG - Intergenic
1130561617 15:84963548-84963570 CCCTGTCCCATACTGTGTTGTGG - Intergenic
1131058695 15:89391356-89391378 CACTCTCTCATCAGGTGTTGTGG + Intergenic
1133230034 16:4362059-4362081 CACTCTCACCAGGTGTGGTGAGG + Exonic
1133235871 16:4387191-4387213 CAGTCTCCCCAGCTGTGTTGTGG + Intronic
1133783124 16:8954472-8954494 AAATCTCACAAGCTGTATTGTGG - Intronic
1137864572 16:51879960-51879982 CTCTCACAGATGCTGTCTTGTGG - Intergenic
1138448034 16:57077060-57077082 CACTCTTACATCCTGTCTTTGGG - Intronic
1139597182 16:67964975-67964997 CACTTTCACATGCTGTGGGAAGG - Intronic
1140489270 16:75320593-75320615 CACTCTCACAGTCTGGGGTGAGG - Intronic
1140625018 16:76783065-76783087 GAATCACACATGGTGTGTTGAGG + Intergenic
1141504066 16:84463149-84463171 TCCTGTCACATGCTGTTTTGAGG - Intronic
1143004157 17:3816589-3816611 CACTTACACATGCTGTGATGTGG + Intronic
1143929755 17:10409821-10409843 CATTTTAACATGCGGTGTTGAGG - Intronic
1146016588 17:29238675-29238697 CACTCACACATGCTTTGCCGTGG - Intergenic
1146589773 17:34118729-34118751 CACACTCACCTCCTGTGTTGGGG - Intronic
1149548415 17:57521657-57521679 CACACACATATGCTGTGTTACGG + Intronic
1150908368 17:69362403-69362425 CACTCTCACCTGCTGGGTTGAGG + Intergenic
1150942111 17:69703990-69704012 CTCTTTCACCTGCTGTGATGGGG + Intergenic
1151669428 17:75563903-75563925 CACTCTCAGGTCCCGTGTTGGGG + Intronic
1157196970 18:45627308-45627330 CACTGTCACATGCTGTGAGCAGG - Intronic
1157473586 18:48007901-48007923 CACTCTCGGAGGCTGTGATGTGG - Intergenic
1157715232 18:49880704-49880726 CAAGCTCACATGCCTTGTTGAGG + Intronic
1157972658 18:52288057-52288079 CACTTTCCAATGCTGTGTTCAGG - Intergenic
1160656838 19:277176-277198 AAATCTCTCATGTTGTGTTGTGG + Intergenic
1161150616 19:2706485-2706507 CACTCTCTCATCCAGGGTTGAGG + Intergenic
1161251916 19:3285226-3285248 CCCTCTCATGTTCTGTGTTGGGG + Intronic
1165610777 19:37150239-37150261 CATTCCCACATGCTGTGTTAGGG + Exonic
1166332784 19:42088398-42088420 CACTCCCACATACTGGGGTGGGG + Intronic
1167520437 19:49951554-49951576 CTCTCTGGCATCCTGTGTTGAGG + Intronic
925080933 2:1065434-1065456 CACTCTCAGAGGGTGTGCTGGGG - Intronic
925373735 2:3366458-3366480 CCCTGTCACCTGCTGTGTTTTGG - Intronic
925579458 2:5395903-5395925 CAATCTCACCTGCTGAGATGTGG + Intergenic
927496211 2:23553575-23553597 CACTCTCAGAGGCTGTGTGAAGG + Intronic
929339215 2:40792590-40792612 CACTCACACATGCTGATTTAGGG - Intergenic
929963555 2:46515161-46515183 CACTTTCATATGCTGTCTAGTGG - Intronic
933941334 2:87247508-87247530 CACTCTCTGAGGCTGTGGTGGGG + Intergenic
936338888 2:111614080-111614102 CACTCTCTGAGGCTGTGGTGGGG - Intergenic
937080321 2:119135787-119135809 CACACTCACTGGCTGTCTTGAGG + Intergenic
937856168 2:126673366-126673388 CACTGTCCCAGGCTGTGGTGAGG - Intronic
939891234 2:147738734-147738756 CAGTCTCAGATGCTGAGTTATGG - Intergenic
941512537 2:166431110-166431132 CACTCCAACATGCTGTGCTGTGG + Intronic
943116890 2:183683754-183683776 AATTCCCACATGTTGTGTTGTGG - Intergenic
945744997 2:213709605-213709627 CACTATCAAAAGCTATGTTGTGG + Intronic
948060006 2:235035860-235035882 CTCTCTCACATGCTCCTTTGGGG + Intronic
948429062 2:237907427-237907449 GACTCTCACATTATGAGTTGAGG + Intronic
948605171 2:239130392-239130414 CGCTGTCACATGCTGAGTGGAGG - Intronic
1171338631 20:24409779-24409801 CTCTCTCACAGGCGGTGCTGGGG - Intergenic
1181045529 22:20212388-20212410 CCCTCTCACATGTTGGGTGGGGG - Intergenic
1182018857 22:27064006-27064028 CACTCTCTGATGCTATTTTGAGG - Intergenic
1185026978 22:48420173-48420195 CACTCTGAGAGGCTGTGTTCCGG + Intergenic
1185163807 22:49245321-49245343 CATTCTCCCATGCTGTGTGTAGG - Intergenic
949210901 3:1499807-1499829 GACTCTCTCTTGCTGTCTTGTGG - Intergenic
949726389 3:7051266-7051288 TATTCTCACAGGCTGTGGTGAGG - Intronic
952929068 3:38346074-38346096 GCCTCTCACATGCTGGGTTTGGG + Intergenic
953660463 3:44887911-44887933 CCCTCTATCATGCTGTGCTGTGG - Intronic
955032764 3:55237075-55237097 CACTCTCACATGCTGCCTGCTGG - Intergenic
956941625 3:74168627-74168649 CACTCTCCCATGCTGGTCTGTGG - Intergenic
957063367 3:75500194-75500216 CACTCTAAAATGCTGTCCTGGGG - Intergenic
959196216 3:103186608-103186630 CATTCTCACATGCTGGGAGGTGG - Intergenic
960573502 3:119207356-119207378 CAATCTGACAACCTGTGTTGTGG + Intergenic
960710817 3:120526167-120526189 CAGGCTGAAATGCTGTGTTGTGG + Intergenic
961290026 3:125839380-125839402 CACTCTAAAATGCTGTCCTGGGG + Intergenic
962369314 3:134807692-134807714 CACTCTCACAGGCTTTACTGAGG + Intronic
963664855 3:148169888-148169910 GAGTCTCACATGGTGTGGTGAGG - Intergenic
963812390 3:149790780-149790802 AACTCTCAAATGCTTTGTTAAGG - Exonic
965162943 3:165158372-165158394 CAGTCTCATATTCTGTGTGGTGG + Intergenic
966954237 3:184857311-184857333 GACTCTCAAATGTTGTATTGGGG - Intronic
967199911 3:187063803-187063825 CACTCACACAGGAAGTGTTGGGG - Intronic
967515806 3:190366973-190366995 CACTCCCACATGCTGCTTTGGGG - Intronic
967719721 3:192802846-192802868 TACTGTGAAATGCTGTGTTGTGG + Intronic
969805712 4:9607264-9607286 CACTCTAAAATGCTGTCCTGGGG + Intergenic
969930844 4:10629310-10629332 CACCCTCACAGGCTGTGTGAAGG + Intronic
970545747 4:17128366-17128388 CACTCCAAGATGCTGTTTTGTGG - Intergenic
974133651 4:57787885-57787907 CACTCTCACATTCAGAGTTCAGG + Intergenic
985714702 5:1448802-1448824 CACTGTGACATGCTGTGCAGTGG - Intergenic
985867100 5:2522566-2522588 CACTCTCTCCTGCTCCGTTGTGG + Intergenic
985944031 5:3162855-3162877 CACGCTCATATGCTGGGCTGGGG - Intergenic
988115493 5:26883628-26883650 AAATCACACATGCTGTGTTCTGG - Intronic
994751116 5:103738028-103738050 ACCTCTCTCCTGCTGTGTTGAGG - Intergenic
999109340 5:149104406-149104428 GACTCTATCATGCTGTGTTGAGG + Intergenic
1000925649 5:167190738-167190760 CACTCTCATCTGCAGTGTTGAGG + Intergenic
1006119961 6:31797979-31798001 TACCCTCACATGGTGAGTTGGGG - Exonic
1007781200 6:44255949-44255971 CTCTCTCACATGCAGTACTGGGG + Intronic
1008346379 6:50432520-50432542 CAGTCTCCCAGGCTATGTTGTGG - Intergenic
1013280991 6:108636775-108636797 CACTCACAAGTGCTGTGTTCTGG + Intronic
1017784306 6:157742209-157742231 CACTCTCAGATGCTGGCTGGGGG - Intronic
1018886898 6:167946888-167946910 CACTCTTACTTGCTACGTTGGGG - Exonic
1019403510 7:869629-869651 CTCTCTCAGATTCGGTGTTGAGG + Intronic
1019585384 7:1799295-1799317 CACTCTCATAAGCAGTGTTTGGG - Intergenic
1020330591 7:7013213-7013235 CAAGCTCTCATGCTGTGTTTTGG + Intergenic
1021919649 7:25471992-25472014 GCCTCTCACATGCAGTGTTTTGG + Intergenic
1026685559 7:72506459-72506481 CATTGGCACATGCTGTGTTTTGG - Intergenic
1027956325 7:84883135-84883157 CAATCTCACAAGCTGTTCTGGGG - Intergenic
1028880256 7:95872088-95872110 CACTTTCACCTGCTGTGGGGAGG + Intronic
1030389855 7:108914059-108914081 AACTCTCAAGTGCTGTTTTGGGG - Intergenic
1030946200 7:115724445-115724467 AATTCTCACATGCTGTGTGTGGG + Intergenic
1032174669 7:129612802-129612824 CTCTCTCACCTGTTGTGTCGTGG + Intronic
1032409390 7:131683521-131683543 CAATCTCACATGGTATGTTAAGG + Intergenic
1036774051 8:11597921-11597943 CACTCTCACATCCTTTGTCTTGG + Intergenic
1036995582 8:13652188-13652210 CACTCTCAGATGGTTTGTTTGGG - Intergenic
1037192305 8:16141313-16141335 CACTCTCACATGTAATCTTGTGG - Intronic
1039885775 8:41653318-41653340 CTCTCCCACATGCTCTGTTATGG - Intronic
1040839263 8:51767516-51767538 CAGTCTCCCATGCTTTGTTCAGG + Intronic
1041458999 8:58091270-58091292 CACTCTCACATCCTGGAATGAGG - Intronic
1042673345 8:71288107-71288129 CATTCTCAGATGGGGTGTTGGGG + Intronic
1042743353 8:72075842-72075864 CACACTCACATGCAAGGTTGGGG - Intronic
1043773543 8:84235638-84235660 AACTATCCAATGCTGTGTTGAGG - Intronic
1044400101 8:91760354-91760376 ATCTCTCACATGGTGTGTTGTGG - Intergenic
1045872140 8:106939204-106939226 CACTCACCCCTGCTGTTTTGTGG + Intergenic
1045880838 8:107038045-107038067 CACTGTCACATGCTGTTGAGAGG + Intergenic
1046426679 8:114061399-114061421 CACTCTCAGATACTTTGTTGGGG - Intergenic
1047583553 8:126243662-126243684 CACTCTCAGATGCTGTTCAGTGG + Intergenic
1048077138 8:131083951-131083973 CCCTCTCTCATTCTGTGTTATGG + Intergenic
1052679696 9:31673502-31673524 CAGTCTCAGTTGCTGTGTTAGGG + Intergenic
1053533367 9:38903580-38903602 CACTCTCCCATGCTGTGTGCAGG + Intergenic
1054205593 9:62128009-62128031 CACTCTCCCATGCTGTGTGCAGG + Intergenic
1054632768 9:67460361-67460383 CACTCTCCCATGCTGTGTGCAGG - Intergenic
1057814358 9:98283566-98283588 CATCCTGACATGCTGTGTTAGGG - Intergenic
1061119108 9:128632377-128632399 CACAGTCACCTGCTGTGTGGAGG + Intronic
1186873495 X:13794829-13794851 CACTGTCACACGCTGGTTTGTGG - Intronic
1187585232 X:20653545-20653567 AATTCTCACGTGTTGTGTTGTGG + Intergenic
1187831488 X:23386983-23387005 ATCTCTCAGCTGCTGTGTTGTGG + Intronic
1190947804 X:55112922-55112944 CACTCACACCTCTTGTGTTGAGG + Intronic
1192148553 X:68697831-68697853 CTCTCTGACAGGCTGTGGTGAGG - Intronic
1193231432 X:79051404-79051426 ACCTCTCACATGCTATGTTATGG - Intergenic
1195522329 X:105845688-105845710 CTCTCCCACCTGCTGTGGTGTGG + Intronic
1202249141 Y:22851924-22851946 CTCTCTCCCATGCTGTGGTATGG - Intergenic
1202402127 Y:24485672-24485694 CTCTCTCCCATGCTGTGGTATGG - Intergenic
1202468653 Y:25184411-25184433 CTCTCTCCCATGCTGTGGTATGG + Intergenic