ID: 1100683134

View in Genome Browser
Species Human (GRCh38)
Location 12:96951948-96951970
Sequence GAATGAAATGCATTCTTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100683132_1100683134 29 Left 1100683132 12:96951896-96951918 CCAAATAAATGTGAAATATCAAT 0: 1
1: 1
2: 5
3: 83
4: 659
Right 1100683134 12:96951948-96951970 GAATGAAATGCATTCTTTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100683134 Original CRISPR GAATGAAATGCATTCTTTGC TGG Exonic
902555511 1:17244433-17244455 GAATGAGGTGCATTCTTCTCGGG - Exonic
903352579 1:22726917-22726939 GAAAGAAGGGCATTCTTAGCAGG + Intronic
904650513 1:32002442-32002464 GAATTAATTCCATTATTTGCCGG + Intergenic
905772666 1:40648397-40648419 GAATGAAACACATGCTCTGCAGG + Intronic
905975389 1:42170535-42170557 GAAAGAAATGGATTCTGTTCTGG - Intergenic
907747382 1:57226856-57226878 GAATGAAATGGTTTCATGGCAGG - Intronic
908602750 1:65758791-65758813 GATGGAAATCCATTCTTTGCTGG + Intergenic
908995755 1:70151428-70151450 TAATGCAATGAATTCTTTACAGG + Intronic
909174720 1:72342526-72342548 GATTGATATGCTTTCTTTGGAGG - Intergenic
909559896 1:76998563-76998585 GAATGTAAAGCATTATTTGCAGG + Intronic
911385295 1:97167606-97167628 GAAAGAAATGCATTTTTTTCAGG + Intronic
912669784 1:111615037-111615059 GAATGGAAGGCATTTGTTGCAGG + Intronic
912893974 1:113565226-113565248 AAATGAAATACATTTTTTTCTGG - Intronic
913522550 1:119659559-119659581 GAATGATAGGCATTCATTGGGGG - Intergenic
913670382 1:121092808-121092830 GAAAGAAAAGCAATCTTTACTGG - Intronic
914022149 1:143880249-143880271 GAAAGAAAAGCAATCTTTACTGG - Intergenic
914349505 1:146828074-146828096 CAATGAAAAGGATTCTTTCCTGG - Intergenic
914660634 1:149788178-149788200 GAAAGAAAAGCAATCTTTACTGG - Intronic
915504116 1:156341765-156341787 GTATAAAATGCATTCTTGGCCGG + Intronic
917765186 1:178208348-178208370 GAAAGGAATGCATTCCTTGGGGG + Intronic
918495820 1:185134530-185134552 GAATGAGATGACTTCTTTGTAGG + Intronic
918732897 1:188020896-188020918 GAATGAAATCATGTCTTTGCAGG - Intergenic
918807955 1:189074452-189074474 TAAGGAAATGAATTTTTTGCAGG + Intergenic
919681524 1:200440356-200440378 AAATGTAATGCAATCTTGGCTGG + Intergenic
920758545 1:208759172-208759194 GCAGGGAATGCAGTCTTTGCAGG + Intergenic
921123460 1:212156797-212156819 GAATAAAATGGATTCCCTGCTGG + Intergenic
921568292 1:216747570-216747592 GAAGGAAATGCAATCATTGTGGG - Intronic
922575877 1:226660292-226660314 TAAGGAAGAGCATTCTTTGCTGG - Intronic
1063798060 10:9535601-9535623 GGACGAAATGCATACTTTGTAGG + Intergenic
1064251329 10:13708527-13708549 GAGTGAAATGCACTCTGAGCCGG - Intronic
1064509919 10:16079004-16079026 GAAGGGAATGAATTCTTTTCTGG + Intergenic
1064972285 10:21078089-21078111 GATGGAAATGCATTCTATGGGGG + Intronic
1065011051 10:21420975-21420997 GAATGAAATGAGTCCTTTACAGG - Intergenic
1065497881 10:26348888-26348910 GAAAGGAATGCATTCTTGGCAGG + Intergenic
1065499652 10:26367033-26367055 GAAAGGAATGCATTCCTGGCAGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066264513 10:33762946-33762968 CCCTGAAATGCATTCTTTGATGG - Intergenic
1066412882 10:35190956-35190978 AAATTAAATGCAGTCTTGGCTGG - Intronic
1067714592 10:48680257-48680279 GAATAAAATACATTCATTTCAGG - Intergenic
1068925012 10:62527152-62527174 GAGTGAAATGGATTCTGTGAGGG + Intronic
1069261441 10:66403251-66403273 GAAAGAAAGGCTTTCATTGCAGG - Intronic
1069453382 10:68535002-68535024 GGTTGAAATACATTCTGTGCTGG - Intergenic
1070094111 10:73319657-73319679 GAAAGAAAGGCTTTCATTGCAGG - Intronic
1070993605 10:80755047-80755069 TCTTGAAATTCATTCTTTGCTGG + Intergenic
1071191314 10:83104754-83104776 GAAATAAATGCATTGTTTGTGGG - Intergenic
1071412910 10:85414179-85414201 TAAAGAGGTGCATTCTTTGCAGG - Intergenic
1072038676 10:91587542-91587564 TAATGCAATGCATGCTTTTCAGG + Intergenic
1073743717 10:106441244-106441266 GAAAGAAATCCATTTTTTACTGG - Intergenic
1078356944 11:10639506-10639528 GAATGAAGTTCCTTCTATGCTGG - Intronic
1080202349 11:29687398-29687420 AAATGAAATCCATTCATTACTGG + Intergenic
1080957616 11:37118645-37118667 GAAGGAAATGCATTCTTCAAAGG + Intergenic
1081230816 11:40583869-40583891 GAATGAAATGCATAGTTTTAAGG + Intronic
1081236144 11:40649310-40649332 GAAAGGAATGCATTCTTGGGGGG - Intronic
1082762006 11:57136465-57136487 GAATGGAATGCAGCCTTAGCTGG + Intergenic
1084223401 11:67699011-67699033 GAAAGGAATGCATTCCTTGGGGG + Intergenic
1084265896 11:68004941-68004963 GAAGGGACTGCATTCTCTGCAGG - Intronic
1085690402 11:78659577-78659599 GCAAGAAATGCATTCTTGGCAGG + Intronic
1087417344 11:97873824-97873846 GAATAAATTGGAATCTTTGCAGG + Intergenic
1087674636 11:101146064-101146086 GATTGAAATACATTTTTTTCTGG + Intergenic
1087861412 11:103162531-103162553 GGATGAAATGTATTATTTGGGGG - Intronic
1088489109 11:110369679-110369701 GAATGAAATACAGTTTTTGTGGG - Intergenic
1089625285 11:119747240-119747262 GAGAGAGATGCATTATTTGCTGG - Intergenic
1090042370 11:123302077-123302099 GGATGGAATGCACGCTTTGCTGG - Intergenic
1090459286 11:126875880-126875902 TAATGAAATGAATACTTTGAGGG + Intronic
1090642807 11:128743816-128743838 CAATGAAATGTTTTCTTTGGAGG + Intronic
1091117183 11:133024324-133024346 GAAGGAAGTGCGTTCTTTACAGG + Intronic
1091869417 12:3875363-3875385 GAAAGAAACGCATTATTTGCAGG - Intergenic
1093495034 12:19746897-19746919 AAATGAAATGAATTTTTTGAGGG + Intergenic
1095358847 12:41310988-41311010 GAAGTAAATGCATTATTAGCAGG - Intronic
1097493581 12:60300131-60300153 GAATGACATGCTTTCTTTTAAGG + Intergenic
1097659103 12:62408288-62408310 TAATGAAATGCATTATCTGTAGG - Intronic
1098048025 12:66422302-66422324 GAATGTTTTGCATTCTTTGCTGG - Intronic
1098398613 12:70049498-70049520 GAATGACAGGGATTATTTGCAGG + Intergenic
1099751403 12:86778734-86778756 GAATTCACTGCATTCTATGCAGG - Intronic
1100194237 12:92225882-92225904 CAATGAAATGCATTCTTTATTGG + Intergenic
1100683134 12:96951948-96951970 GAATGAAATGCATTCTTTGCTGG + Exonic
1100915957 12:99422102-99422124 TAAAGAAATGCCTGCTTTGCTGG - Intronic
1102355569 12:112231954-112231976 AAATGAAATGCAGTCTGTGTCGG - Intronic
1102763077 12:115406740-115406762 AAATAAAATGCATTCTTTTGTGG - Intergenic
1105634707 13:22206192-22206214 AAATGAAATGCATTGTTTAAAGG + Intergenic
1105897775 13:24731782-24731804 GAAAGGAATGCATTCCTCGCGGG - Intergenic
1107332707 13:39319114-39319136 CAGTTAAATGCTTTCTTTGCTGG - Intergenic
1109128786 13:58553432-58553454 AAATTAAATGCATTCTTTATGGG + Intergenic
1109192743 13:59345080-59345102 GAATGAAACCAATTCTCTGCTGG + Intergenic
1109201276 13:59434592-59434614 GAATGAAATGGACTCTGTGATGG + Intergenic
1109706046 13:66094275-66094297 GAAAGCAATGCATTCATTTCAGG + Intergenic
1111316194 13:86563273-86563295 GATTGAAATGGATACTTTGAAGG + Intergenic
1113312465 13:109144436-109144458 GAAGGAAAAGCATTCAGTGCTGG + Intronic
1113597043 13:111540603-111540625 GGATGAAATGCATCCACTGCAGG + Intergenic
1113757080 13:112819998-112820020 GTTAGAAATGCATTCTTTGACGG + Intronic
1114208121 14:20592297-20592319 GAAAGAAAAGCATTCTTTGAAGG - Intronic
1115890541 14:38022737-38022759 GGAAAAAATGCATTCTTTTCAGG - Intronic
1115978934 14:39028635-39028657 AAAGCAAATGCATTCTTTACTGG - Intergenic
1116562647 14:46401161-46401183 GAAATAAATGCATTCTCTTCTGG + Intergenic
1119299798 14:73562642-73562664 GAAAGGAATGCATTCCTGGCGGG + Intergenic
1119514899 14:75240354-75240376 TAAGGAAATGCAGTCTTGGCTGG - Intronic
1120015412 14:79467613-79467635 AAAAGAAATTCATTCTTTGCAGG + Intronic
1120262877 14:82209985-82210007 GATTGAAATGAATTTTTTTCTGG + Intergenic
1121686249 14:95837435-95837457 CATTGAAATCCATACTTTGCAGG + Intergenic
1121786108 14:96662339-96662361 GAAAGAAATGCATTAGTTGAGGG - Intergenic
1125239031 15:37551427-37551449 AAATGAAAGACATTCTTTGTAGG + Intergenic
1129562724 15:76589126-76589148 GAATGAAATGGACTCTGTGAGGG + Intronic
1130842440 15:87713639-87713661 GAATGTAAGGCTTTCTTTCCTGG + Intergenic
1131843164 15:96459532-96459554 AATTGAAATACATTCTTTCCTGG - Intergenic
1134885096 16:17783794-17783816 AAATAAAATGCATTCTTCACAGG - Intergenic
1134895091 16:17879063-17879085 GATTCCAAGGCATTCTTTGCAGG + Intergenic
1135171551 16:20188532-20188554 GATTGAAGTGGATTCTTTGTGGG - Intergenic
1135737866 16:24947035-24947057 GAATTAAATGGCTTCTCTGCTGG + Intronic
1135738065 16:24949331-24949353 GAATTAAATGACTTCTCTGCTGG + Intronic
1135934225 16:26765816-26765838 TAATGAATTGCATTTTTTGGAGG - Intergenic
1135967008 16:27044110-27044132 GAATGAAATCATGTCTTTGCAGG - Intergenic
1136111861 16:28068492-28068514 TAATGAAATTCATACTTTTCAGG + Intergenic
1137425273 16:48374111-48374133 GAAGATAATACATTCTTTGCTGG - Intronic
1138984875 16:62316249-62316271 AAAAGAGATGCATTCTTTGCTGG + Intergenic
1139329992 16:66180343-66180365 AAATAAAAAGCATTCTTTCCTGG + Intergenic
1139984532 16:70887480-70887502 CAATGAAAAGGATTCTTTCCTGG + Intronic
1143956408 17:10673510-10673532 GAATGGAATGTAATCCTTGCAGG + Exonic
1144370638 17:14587573-14587595 GAATGAAATGGCTGCTTTGAAGG - Intergenic
1146767865 17:35540277-35540299 GAATAAAAAACATTCTTTGACGG - Intergenic
1149536946 17:57440626-57440648 GAATGAATGGCAGTCTGTGCAGG + Intronic
1150048066 17:61932703-61932725 GAATGAAAAGCATTCTAGACAGG - Intergenic
1150660906 17:67077613-67077635 GAGTTAAAGGCATTCTTTGCAGG - Exonic
1151035754 17:70797306-70797328 GAAGGAAATGGATTCTTCCCTGG - Intergenic
1151856174 17:76723735-76723757 GAAGAAAGTACATTCTTTGCCGG - Intronic
1151965867 17:77431044-77431066 GATTGAAAAGCAATCTTTGCTGG + Intronic
1153875484 18:9366643-9366665 GACAGAAATCCATTCTATGCAGG - Intronic
1154370396 18:13756252-13756274 GTATAAAATGCCTTCTATGCAGG - Intronic
1155710653 18:28874073-28874095 GTGTGAAATGCATTTTTTTCTGG - Intergenic
1156140594 18:34105070-34105092 GGTTTAAATGCATTCTTTTCTGG + Exonic
1156415868 18:36889640-36889662 AACTAAAATGCCTTCTTTGCAGG + Intronic
1157244388 18:46040599-46040621 GAAAGAAAGGCATTTATTGCAGG - Intronic
1158730715 18:60019658-60019680 GCATAAAATGCATTCTTTGCCGG + Intergenic
1159834181 18:73316415-73316437 GAATAAAATGCATTCATCACTGG + Intergenic
1165044429 19:33093512-33093534 GAAGGAAATGCTCACTTTGCTGG - Exonic
1165078225 19:33292510-33292532 AAATGAAAGGCATCCTTTGTGGG + Intergenic
925095166 2:1192771-1192793 CCATGAAATGCAATTTTTGCTGG - Intronic
925123190 2:1435459-1435481 AAATGGAATGCATTCCTTCCTGG + Intronic
925296789 2:2782509-2782531 GAATGCAATGCATTCTCTGGAGG - Intergenic
926358108 2:12059734-12059756 GAATGCATTGCAGTCATTGCTGG + Intergenic
926836230 2:17024714-17024736 GAAAGGAATGCTTTCTTTCCAGG + Intergenic
927186120 2:20483864-20483886 GAATGAGGTTCATTCTTTTCTGG + Intergenic
927832773 2:26367818-26367840 TAATGAAAAGCATTCTTGGCAGG - Intronic
930562560 2:52978914-52978936 GAAAGAAATGATTTCATTGCTGG - Intergenic
933722704 2:85408586-85408608 GAATGGAATAGACTCTTTGCTGG - Intronic
934077148 2:88438152-88438174 GAATGAAATTCATTTTAGGCTGG - Intergenic
936941515 2:117889096-117889118 GAATGAAAGTCATCCATTGCAGG + Intergenic
938055862 2:128214343-128214365 GATAGAAAGGCATTTTTTGCTGG - Intergenic
939280082 2:140052706-140052728 AAAGGAAATGCATACTCTGCTGG + Intergenic
939306167 2:140414987-140415009 GAAAGGAATGCATTCCTTGGGGG + Intronic
940254963 2:151718794-151718816 GAAGGATATGCATTATTTGTGGG - Intronic
940762437 2:157752036-157752058 GAATGAAATGGACTCTGTGAGGG - Intronic
942551775 2:177127272-177127294 AAGTGAAATGCATTGTTTCCAGG + Intergenic
942997169 2:182276805-182276827 GAAAGGAATGCATTCGTTGGGGG + Intronic
943137455 2:183932585-183932607 GAATGGAATTCAATCTGTGCCGG + Intergenic
943516038 2:188888054-188888076 GCATGAGATGCATTTTTTTCTGG + Intergenic
944040256 2:195345380-195345402 GAATGAAAAGCATTGTGTGTAGG + Intergenic
944353962 2:198763096-198763118 GTCTGAGATGCATTGTTTGCAGG + Intergenic
945424767 2:209687354-209687376 AAAACAAATGCATTCTTTGGAGG - Intronic
945667715 2:212762812-212762834 GAAAGAAATGCATTCTCTCAGGG + Intergenic
946346893 2:219118259-219118281 GAATGAAATCCATTGGGTGCTGG - Intronic
946620543 2:221557322-221557344 AAATGAAATGGTTTCTTTGTTGG + Intronic
947552735 2:231057928-231057950 CAATAAAATGCTTTCTTTGTGGG - Intronic
947560213 2:231142951-231142973 GAATGAACTGAATCCTTTGTTGG - Intronic
1169701525 20:8452666-8452688 GAATCAAATGCTTCTTTTGCAGG - Intronic
1169823432 20:9740099-9740121 GAATTAAAAGCGTTCTTTGGTGG + Intronic
1171422751 20:25029613-25029635 GAATAATATGCATTCATTGATGG - Intronic
1171449830 20:25227492-25227514 AAATGACTTGCATACTTTGCCGG - Intergenic
1172493932 20:35364457-35364479 GTATGACATGCATTCTTTTCTGG - Intronic
1173533658 20:43791294-43791316 CAATGAAATGGATTATTTTCTGG - Intergenic
1173559849 20:43995328-43995350 GAATGAAATGCAATTTTGTCAGG - Intronic
1173782884 20:45771363-45771385 GACTGGAAAGAATTCTTTGCTGG - Intronic
1174764160 20:53236050-53236072 GAATTGACTGCTTTCTTTGCTGG - Intronic
1174841664 20:53907064-53907086 GTAGGCTATGCATTCTTTGCTGG + Intergenic
1175677405 20:60958656-60958678 GAGTTTAATGCATTCTTAGCTGG - Intergenic
1177072454 21:16527531-16527553 TATTGAAATACATTCTTGGCCGG - Intergenic
1177454810 21:21323022-21323044 CAATGAAATGAATTCTTTCATGG - Intronic
1179147035 21:38776903-38776925 CAAAGAAATGAATTCTCTGCTGG + Intergenic
1179802991 21:43820233-43820255 GAATTAACTGCAGTCTATGCAGG - Intergenic
1180375579 22:12089985-12090007 GAATGAGATGTATTTTTTGAAGG + Intergenic
1180690777 22:17713754-17713776 GCATTAAATGCATTTTTGGCTGG - Intronic
1183244241 22:36681531-36681553 GAATTAAATCCATTTTTTGGGGG + Intronic
949196393 3:1314275-1314297 GTAGCAAAGGCATTCTTTGCTGG + Intronic
949680017 3:6502857-6502879 GCATGAAATGCGTTCATTGGTGG + Intergenic
950621720 3:14211257-14211279 AATTGAAATGCATTCTCTGTGGG + Intergenic
951227640 3:20139747-20139769 AAATGAAATCCTTTCTTTGCAGG - Intronic
951450696 3:22834624-22834646 GAAAGAAAAGCATTTATTGCAGG - Intergenic
953182360 3:40607961-40607983 GAATAAGATGCATTCTTGGCCGG + Intergenic
953226274 3:41024585-41024607 GAATGACTTGCATTGTCTGCAGG - Intergenic
955085002 3:55694003-55694025 GAATTAAATGTCATCTTTGCCGG - Intronic
956310899 3:67878955-67878977 TAATGAAATGCATTTTTCACTGG + Intergenic
957010223 3:74996555-74996577 GAAAGATATGCATCTTTTGCAGG + Intergenic
957224629 3:77427568-77427590 GAAAGAAATGCTGTCTTTCCTGG + Intronic
957246125 3:77719131-77719153 AAATCAACTGCATACTTTGCTGG + Intergenic
957333688 3:78799172-78799194 GTATGGAATCCATTCTTTGGTGG + Intronic
958624899 3:96611509-96611531 GTATGACAATCATTCTTTGCGGG - Intergenic
958820208 3:98964840-98964862 GAATGAAATGTATTTCTTCCAGG + Intergenic
959386137 3:105709987-105710009 GAAAGAAATGCAATCTTTGTTGG + Intronic
960646349 3:119888794-119888816 GAAAGAAATGCATTCCTTGGGGG + Intronic
960709142 3:120510180-120510202 GAATGATATGCATTCCTTTAAGG + Intergenic
960871586 3:122254975-122254997 GAGTGAGATGCATTCTTGGCAGG - Intronic
963473282 3:145771462-145771484 GAAAGGAATGCATTCTTGGGGGG - Intergenic
964139774 3:153384411-153384433 GAAAGAAAAGCATCCTATGCGGG + Intergenic
964423284 3:156527599-156527621 ACATGAAATGCCTTCTTTACAGG + Intronic
965492913 3:169361850-169361872 GTATGAACTGCATTCTTTCTCGG - Intronic
965843907 3:172939251-172939273 GAAAGAAAGGCTTTATTTGCAGG - Intronic
968342440 3:197967815-197967837 GAAAGGAATGCATTCCTTGGGGG - Intronic
968746067 4:2361177-2361199 GAACGAAATGCCTTCTTTACGGG - Intronic
969485398 4:7469777-7469799 GAAGGAAAGAAATTCTTTGCAGG - Intronic
970371959 4:15417109-15417131 GAATGAAATGCACTAGTTTCAGG - Intronic
970956476 4:21817627-21817649 GAAAGGAATGCATTCCTTGCGGG + Intronic
971261529 4:25061575-25061597 TAATGAAGTGCATTTTTTGTTGG - Intergenic
974041774 4:56863755-56863777 TAATCAAATGCATTTCTTGCTGG + Intergenic
975814096 4:78199450-78199472 GAAAGAAATGAATTCTTTGGGGG + Intronic
976649322 4:87418301-87418323 GAAAGGAATGCATTCCTGGCGGG + Intergenic
976848960 4:89523160-89523182 CAATCAAATGGATTTTTTGCTGG + Intergenic
977426940 4:96878226-96878248 GAATGCATTGCATTCTTTTGTGG - Intergenic
978096552 4:104786055-104786077 GAGGGAAATGCAATCTTTGAGGG - Intergenic
980546093 4:134263834-134263856 GAATAAAATGCAATCATTACTGG + Intergenic
981858077 4:149319112-149319134 GAAAGAAATGCATTTATTACTGG - Intergenic
982451094 4:155552829-155552851 GAATGAAATGGACTCTGTGAGGG - Intergenic
983128313 4:163982321-163982343 AAATGAAATGCATTTTTAGCAGG - Intronic
983190924 4:164752692-164752714 GAAAGGAATGCATTCCTTGGGGG + Intergenic
983306329 4:165993754-165993776 GAACAAAATGCATTCTATTCTGG - Intronic
1202757177 4_GL000008v2_random:75427-75449 GAATGAGATGTATTTTTTGAAGG + Intergenic
987042219 5:14073569-14073591 GGATGCAATGCATGCTTTCCAGG + Intergenic
987816656 5:22910378-22910400 GGATGTAATGCATGCTTTGGGGG + Intergenic
987901953 5:24023697-24023719 GAGTGAAATGGACTCTTTGAGGG - Intronic
988281509 5:29153496-29153518 TAATGATATGCATACTTTCCAGG - Intergenic
988702722 5:33691484-33691506 GAATGGAATGCTTTCTTTTTAGG + Intronic
989643949 5:43608747-43608769 GAATTACATGCACTTTTTGCTGG + Intronic
991101385 5:62797288-62797310 GAAAGGAATGCATTCTTGGGGGG - Intergenic
992185107 5:74236990-74237012 GAATAAATTGCCTTCTTTGAAGG + Intergenic
992737244 5:79734786-79734808 GAAGGAGATTCATTCTTTGATGG + Exonic
992943880 5:81790272-81790294 GTATGAAATGCATTCCAGGCTGG + Intergenic
994023592 5:95056146-95056168 GAATGTAATGAGTTCTTTGTTGG + Intronic
994496605 5:100520628-100520650 GAATGAAATGGACTCTGTGAGGG - Intergenic
994855708 5:105115864-105115886 GAATATAATGCATTCTTTTTAGG - Intergenic
995118283 5:108506591-108506613 GAATGAAATGCAAGCTTTAAAGG - Intergenic
995192581 5:109333914-109333936 CAATGAAATTCATCCCTTGCAGG + Intergenic
995834783 5:116389021-116389043 GAATGACATGCAATCTGAGCAGG - Intronic
996570884 5:124931426-124931448 GAAAGTAATGAATTCTTGGCTGG + Intergenic
996607671 5:125343048-125343070 GAATTCATTGCATTCTTTGTGGG + Intergenic
996933512 5:128920122-128920144 GATGAAAATGCATTCTTTGCAGG - Intronic
998222024 5:140290776-140290798 GAATAAAATGCATTCATTTTAGG - Intronic
998746129 5:145261410-145261432 GAATGAAGTGGATTCTGTGAGGG - Intergenic
1001354957 5:171010447-171010469 GAATAAAATTCATTATTTTCTGG + Intronic
1003753484 6:9089307-9089329 GAATGAAATGATATCTTTACGGG + Intergenic
1005170976 6:22984284-22984306 GAATGAGATCAAGTCTTTGCAGG + Intergenic
1005392227 6:25345218-25345240 CCATGAAATACATTCTTTACAGG + Intronic
1005820450 6:29594150-29594172 GAAAGAAAGGCATTTGTTGCAGG - Intronic
1006742333 6:36318250-36318272 GAATGAAATGTTCTGTTTGCTGG - Intronic
1008242755 6:49131761-49131783 GCATGAAATGCATATTTTGATGG + Intergenic
1010520284 6:76823940-76823962 GAAAGGAATGCATTCCTTGTGGG - Intergenic
1011860586 6:91750625-91750647 GAATGACATTGACTCTTTGCTGG + Intergenic
1012219470 6:96630888-96630910 GAAGAAAATACATGCTTTGCAGG - Intergenic
1013627376 6:111951369-111951391 CAATGAAATACAGTCTTTTCTGG + Intergenic
1013987012 6:116206631-116206653 GAAAGAAATTCATAATTTGCAGG - Intronic
1014118353 6:117692086-117692108 GAAAGAAATTGAATCTTTGCTGG + Intronic
1014118415 6:117693477-117693499 GAAAGAAATTGAATCTTTGCTGG + Intronic
1015378773 6:132542663-132542685 GCATGGTATGCAGTCTTTGCAGG - Intergenic
1017235257 6:152111821-152111843 GAAGGAAATGCTTCCCTTGCTGG - Intronic
1019265455 7:114624-114646 GAAGGAAAAGCATGTTTTGCTGG + Intergenic
1019953281 7:4390699-4390721 GAATGAAATGCATGCTGAACAGG - Intergenic
1021364826 7:19764464-19764486 CAATGAAATGGAGTCTTTGTGGG - Intronic
1022237979 7:28480420-28480442 CAATGAAATACTTTCTTTTCTGG + Intronic
1022245329 7:28553709-28553731 GAATGAAAGTGATTCTTTGCTGG + Intronic
1022830999 7:34066711-34066733 GAATCAGATAAATTCTTTGCTGG + Intronic
1023334908 7:39158771-39158793 GATTGAAATGCCGTCTTTTCTGG + Intronic
1023613480 7:41994687-41994709 GAATGAAATTCTTACTTTGGTGG - Intronic
1024342082 7:48276359-48276381 TAATGAAATTCATTATTTGAAGG - Exonic
1024886179 7:54145496-54145518 GAAAGAAATGTGTTCTTGGCTGG + Intergenic
1026374024 7:69732125-69732147 CAATGAAATTCAGTCTTTGGGGG + Intronic
1026588030 7:71673302-71673324 GAATGTAATGCATTCATGGTTGG + Intronic
1027556222 7:79668108-79668130 GAATGAAAAGCATTCTGTAGTGG + Intergenic
1027565085 7:79781508-79781530 GAATGAAATGTAATCTTTAGGGG - Intergenic
1028172841 7:87619241-87619263 GAATGAAATGTAAGCTTGGCTGG + Intronic
1029008531 7:97234297-97234319 GAAAGGAATGCATTCCTGGCGGG + Intergenic
1029668035 7:102008414-102008436 GAATGAAAATCCCTCTTTGCTGG - Intronic
1029869133 7:103670204-103670226 GAATGATATGCATTCTTGGTAGG + Intronic
1029892543 7:103945507-103945529 GAAGGAAGAGCATTCTTTGCAGG - Intronic
1031680264 7:124664498-124664520 CAAGGAAATGGATTCTTTTCTGG + Intergenic
1031828008 7:126589710-126589732 GAGTGAAATGCATTCTGTGAGGG - Intronic
1035591436 8:817873-817895 GAATGAAATGGACTCTGTGAGGG + Intergenic
1036672289 8:10799486-10799508 GAATGAACTGGAATCTTTGGTGG - Intronic
1037226145 8:16592927-16592949 GAATGAAAGGCAGACATTGCTGG + Intergenic
1037713553 8:21376253-21376275 GAGTGAAATGCACTCTGTGAGGG + Intergenic
1038197212 8:25379317-25379339 GAAAGGAATGCATTCCTTGGGGG - Intronic
1038232686 8:25718170-25718192 GATGGAAATGCACTTTTTGCAGG + Intergenic
1041162718 8:55061344-55061366 GAAGGAAGTGTATTCTTTTCAGG - Intergenic
1042075569 8:64990578-64990600 TAATGTAAGGCATTATTTGCAGG + Intergenic
1042095815 8:65214688-65214710 GAGTGGAATGCATTCTGTGTGGG + Intergenic
1042714723 8:71760211-71760233 GAATCAAATGCATTTCGTGCTGG + Intergenic
1042934096 8:74041576-74041598 GAAAGGAATGCATTCCTTGGGGG + Intergenic
1043373783 8:79624635-79624657 GGATGAAATGTATACTTTTCTGG - Intronic
1043987860 8:86715276-86715298 GAATGAAGTGGACTCTGTGCAGG - Intronic
1044691794 8:94887547-94887569 AAATGAAATGCATACTGTGTTGG - Intronic
1046089118 8:109477775-109477797 GAATCCAATGCTTTCTTAGCAGG + Intronic
1046226025 8:111282039-111282061 GAACTAAATAAATTCTTTGCAGG + Intergenic
1046731835 8:117734518-117734540 GAATAAAAGGCTTTATTTGCAGG - Intergenic
1047890378 8:129302608-129302630 GAATGAAGTGGACTCTTTGAAGG + Intergenic
1048453865 8:134559497-134559519 GCATGAAATGCTTACTGTGCAGG - Intronic
1050210435 9:3248306-3248328 TAATGAAATGCTTTCATGGCAGG - Intronic
1051917777 9:22229143-22229165 GAATGCACAGGATTCTTTGCTGG - Intergenic
1052289445 9:26825446-26825468 GTATTAAATGCATTTTTGGCTGG - Intergenic
1053212337 9:36241517-36241539 GTATGAAATGTATTCTTGCCAGG - Intronic
1055704669 9:78984578-78984600 TAAAAAAATGCATTCTATGCAGG + Intergenic
1056299020 9:85222678-85222700 GCAAGAAATGGATTCTTTCCTGG - Intergenic
1060275894 9:122182252-122182274 GAGGGAAAGGCATTCTGTGCTGG - Intronic
1060780587 9:126409438-126409460 GATAGAAATGCCTCCTTTGCAGG + Intronic
1203537968 Un_KI270743v1:60287-60309 GAATGAGATGTATTTTTTGAAGG + Intergenic
1186884530 X:13899812-13899834 GAATGAAATGCAGTCATTATTGG + Intronic
1186912593 X:14185021-14185043 GAATGACATATGTTCTTTGCAGG + Intergenic
1186931760 X:14399437-14399459 GAATGAAGTGTTTTCTTTTCAGG + Intergenic
1189176378 X:38961769-38961791 GAATGAAATCATGTCTTTGCAGG - Intergenic
1189206582 X:39244778-39244800 GAAAGCAATGCATGCTTTGAGGG + Intergenic
1192155442 X:68743013-68743035 GAATGAAATAAATTCTTTTGTGG + Intergenic
1192489564 X:71563530-71563552 GAAATAAATGCATACTTGGCGGG - Intronic
1193680931 X:84518381-84518403 GGGTGAAATGCATTCTGTGAGGG + Intergenic
1193926586 X:87493484-87493506 GAAAAAAATGCATTCTTGGCTGG - Intergenic
1194299038 X:92162743-92162765 GAATGAAATGGACTCTGTGAGGG + Intronic
1195447810 X:104974019-104974041 CAAAGAAATGTATTCTTTACTGG - Intronic
1197572109 X:128162886-128162908 GAATGAAATGGACTCTGTGAAGG + Intergenic
1198632399 X:138655060-138655082 GAATGAAATGCATTTTTAGGTGG - Intronic
1200616641 Y:5387577-5387599 GAATGAAATGGACTCTGTGAGGG + Intronic
1201096564 Y:10625194-10625216 GAACGAATTGCATCCTTTGCCGG - Intergenic
1201616760 Y:15909037-15909059 GAAAGAAATGCATTCCTGGGGGG - Intergenic