ID: 1100683221

View in Genome Browser
Species Human (GRCh38)
Location 12:96953372-96953394
Sequence ACATTTGTACTGAAGCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 3, 3: 73, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100683217_1100683221 27 Left 1100683217 12:96953322-96953344 CCAAAAATAAAAACAGGAATATT 0: 1
1: 0
2: 4
3: 139
4: 1360
Right 1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG 0: 1
1: 1
2: 3
3: 73
4: 178
1100683220_1100683221 -4 Left 1100683220 12:96953353-96953375 CCAGTGTGGTTTATAGCATACAT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG 0: 1
1: 1
2: 3
3: 73
4: 178
1100683219_1100683221 -3 Left 1100683219 12:96953352-96953374 CCCAGTGTGGTTTATAGCATACA 0: 1
1: 0
2: 2
3: 6
4: 141
Right 1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG 0: 1
1: 1
2: 3
3: 73
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100683221 Original CRISPR ACATTTGTACTGAAGCATAT AGG Intronic
903339817 1:22646940-22646962 ACATTTGTGATGAAGCAAGTAGG - Intronic
904170328 1:28587492-28587514 ACACTTGTGCTGAAGCATTTTGG + Intergenic
905059957 1:35131528-35131550 ACACTTGTGCTGAAGCATTTTGG + Intergenic
906468693 1:46108675-46108697 ACATTTAGAATGAAGGATATGGG - Intronic
906498946 1:46326143-46326165 ACACTTGTGCTAAAGCATTTTGG + Intergenic
906923760 1:50092281-50092303 ACATTTGAGCTGAATCTTATAGG + Intronic
908137114 1:61144509-61144531 ACATTTGTACCTAAGGATGTGGG + Intronic
910273655 1:85424444-85424466 ATATTTGTGCTGAAAAATATAGG - Intronic
910836138 1:91513461-91513483 AGATTTGTACTGAATCATTTTGG + Intronic
910852551 1:91663012-91663034 ACACTTGTGCTGAAGCATTTTGG + Intergenic
912014027 1:105009142-105009164 ACATTTTTACTTAAGAATGTGGG + Intergenic
914720077 1:150282379-150282401 CCCTTTGTACTGTAGCAAATGGG + Intergenic
915963976 1:160290585-160290607 ACATTTGTGCTGCATCATATCGG - Exonic
916208883 1:162342303-162342325 AGATTTGAACTGAAGAATATAGG + Intronic
917116184 1:171606226-171606248 ACACTTGTGCTGAAGCATTTTGG - Intergenic
918646752 1:186914937-186914959 ACACTTGTGCTGAAGCATTTTGG + Intronic
918822698 1:189276643-189276665 ACAATTTTACTGAATTATATGGG + Intergenic
920981110 1:210836265-210836287 AGCTTTGTACTTAGGCATATAGG + Intronic
921539014 1:216389706-216389728 GTATTTGTACTGAAGAAAATGGG - Intronic
924138544 1:240998040-240998062 ACATTTTTCCTGAGGCATAACGG - Intronic
924156776 1:241184787-241184809 ACTTTTGGTCTGAAGCATTTTGG + Intronic
1063013965 10:2055981-2056003 ACATTTGTACCCAATTATATTGG + Intergenic
1065802030 10:29361007-29361029 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1066721368 10:38343534-38343556 ACATTTTGACGGCAGCATATAGG - Intergenic
1068246423 10:54376747-54376769 ATATTGGTATGGAAGCATATAGG + Intronic
1068671379 10:59727024-59727046 ACACTTGTGCTGAAGCATTTTGG + Intronic
1069021641 10:63494976-63494998 ACTTTTGTATGGAAGCTTATAGG - Intergenic
1069320068 10:67158788-67158810 ACACTTGTGCTGAAGCATTTTGG - Intronic
1071282649 10:84116606-84116628 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1071836598 10:89424488-89424510 AAATTTGGAATGAAGGATATGGG + Intergenic
1072046896 10:91666205-91666227 ATATTCATACTGAAGCATTTAGG + Intergenic
1072335234 10:94392023-94392045 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1072384236 10:94907811-94907833 ACTTTTGTACTGAAGTCTTTAGG + Intergenic
1074961606 10:118450701-118450723 ACATTTGTACCCAAGCATTTCGG - Intergenic
1075132901 10:119755580-119755602 GCTTTTGTAATGAAGCATTTTGG - Intronic
1083081832 11:60101946-60101968 ACACTTGTGCTGAAACATTTTGG + Intergenic
1083090311 11:60192614-60192636 ACATTTGTGCTGAAGCATTTTGG - Intergenic
1083197604 11:61098270-61098292 ACACTTGGGCTGAAGCATTTTGG - Intergenic
1085972432 11:81609414-81609436 ACATTTATTCTCAAGCATCTGGG - Intergenic
1086083958 11:82936074-82936096 AAATTTGCACTGAAGAATTTAGG - Intronic
1086973039 11:93104087-93104109 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1091814081 12:3422941-3422963 ACACTTGTGCTGAAGCATTTTGG + Intronic
1093822902 12:23643601-23643623 ACATTTATACTCAGGCAGATAGG + Intronic
1094116248 12:26917413-26917435 ACTATTGTACTGGAGCTTATCGG - Exonic
1094344987 12:29457891-29457913 ACATTTGAGCTGATGCATAAAGG + Intronic
1096208033 12:49740000-49740022 ACACTTGTGCTGAAGCATTCTGG - Intronic
1097461493 12:59869076-59869098 AGATTGGTATTGAAGCACATGGG + Intergenic
1097785807 12:63757713-63757735 AGGTTTCTACTGAAGCATATTGG - Intergenic
1098639169 12:72818892-72818914 ACACTTGTGCTGAAGCATTCTGG + Intergenic
1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG + Intronic
1100994052 12:100282766-100282788 AAATTTGTACTAAAGTGTATTGG + Intronic
1101028096 12:100633604-100633626 ACACTTGTGCTGAATCATTTTGG + Intergenic
1101085677 12:101233472-101233494 ATCTTTATACTGAAGCAAATGGG + Intergenic
1103356467 12:120325158-120325180 TCATTTCTCCTGAAGCATCTTGG - Intronic
1105641225 13:22267165-22267187 ACATATGTACTGCTGCCTATTGG + Intergenic
1105695987 13:22889254-22889276 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1108058964 13:46514268-46514290 ACATCTGCACAGAAGTATATTGG + Intergenic
1109710379 13:66151546-66151568 AAATTTGTACTGCAGTATACAGG - Intergenic
1109803416 13:67405326-67405348 ACACGTGTACTGAAGCATTTTGG - Intergenic
1110587477 13:77210994-77211016 ACCTTTATACTGTAGCATAGTGG - Intronic
1111060608 13:83013830-83013852 ACATTTGTAATCCAGCATTTTGG - Intergenic
1111309278 13:86460322-86460344 ACAGTTGTATTGAATAATATTGG + Intergenic
1111516818 13:89344148-89344170 ATATTTGTTAAGAAGCATATTGG - Intergenic
1114823804 14:26053125-26053147 AAATTGGTATTGAGGCATATGGG + Intergenic
1116240635 14:42338330-42338352 ACACTCGTGCTGAAGCATTTTGG + Intergenic
1116784709 14:49274915-49274937 ACATTTGTATTTCAGCCTATAGG + Intergenic
1116859954 14:49986779-49986801 ACATTTTCACTGAAACAGATAGG + Intronic
1117447645 14:55820117-55820139 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1118565310 14:67134027-67134049 ACATATAAACTGAAGCATAGAGG - Intronic
1119119762 14:72063756-72063778 AGATTTGTACGGAGACATATAGG + Intronic
1120415220 14:84210531-84210553 ACAGTTATATTGAAGTATATTGG - Intergenic
1120476504 14:84995369-84995391 ACAATTGTACTAAAACAAATTGG + Intergenic
1124241882 15:28035219-28035241 ATAATTGTAGTTAAGCATATAGG + Intronic
1127095796 15:55511260-55511282 ACAGTTGTTCTGAAGCATTTTGG + Intergenic
1127926249 15:63546520-63546542 ACAGTTGTATTGAAGCTTTTTGG - Intronic
1129486750 15:75881089-75881111 ACATTTTTACTAATTCATATGGG + Intronic
1137041286 16:35615194-35615216 ACACTCGTGCTGAAGCATTTTGG + Intergenic
1140059767 16:71558015-71558037 AGATGTGTACTGAGGCGTATGGG + Intronic
1143687343 17:8528594-8528616 ACACATGTACTTAAGCACATGGG + Intronic
1144362149 17:14505764-14505786 ACATGTGTACTGATGCAGAGGGG - Intergenic
1145000793 17:19303187-19303209 AGATGTGTACTGAAGCATTTAGG - Intronic
1146764584 17:35507785-35507807 ACACTTGTGCTGAAGCATTTTGG - Intronic
1147809897 17:43160817-43160839 ACACTTGTGCTGATGCATTTTGG + Intergenic
1148828547 17:50413251-50413273 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1152455376 17:80412942-80412964 ACAGTTGTGCTGAAGCATTTTGG - Intergenic
1153137496 18:1933357-1933379 ACATTTACTCTGAATCATATAGG + Intergenic
1153830793 18:8920780-8920802 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1155457696 18:26037522-26037544 ACATTTGTACTTAAGGACATTGG - Intronic
1159501852 18:69282021-69282043 ACATTAGTACCTAAGCATTTGGG + Intergenic
1159552880 18:69914544-69914566 GCATTTCTACTGAAGTAAATTGG + Intronic
1160165778 18:76511157-76511179 ACATTTGTTTTTAAGCGTATTGG - Intergenic
1161830630 19:6601545-6601567 ACACTTGTGCTGAAGCATTTCGG - Intronic
1162632935 19:11943007-11943029 ACACTTGTGCTGAAACATTTTGG + Intronic
1163878495 19:19897234-19897256 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1163942788 19:20510432-20510454 ACACTTGTGCTGAAACATTTTGG + Intergenic
1163992306 19:21010003-21010025 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1164165066 19:22665411-22665433 ACATTTGTTCTCAAGTATAAAGG - Exonic
1164166881 19:22686879-22686901 ACATTTGTTCTCAAGTATAAAGG - Intergenic
1167910025 19:52694183-52694205 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1167935093 19:52899101-52899123 ACACTTGTGCTGAATCATTTTGG + Intergenic
926491026 2:13526518-13526540 ACACTTGTGCTGAAGCATTTTGG + Intergenic
929068260 2:38002282-38002304 ACACATGTACACAAGCATATGGG + Intronic
929256682 2:39818701-39818723 ACATTTATACTGAATCCTAAAGG - Intergenic
933107652 2:78352841-78352863 CCATTTGTTCTGAAGCAGCTAGG + Intergenic
933217739 2:79649824-79649846 ACTTTTTTTCTGAAGCAAATTGG + Intronic
935389849 2:102539611-102539633 ACATTTCCACTGAAGAAAATGGG + Intergenic
935721064 2:105979668-105979690 ACACTTGTGCTGAAGCATTTTGG + Intergenic
935970989 2:108530879-108530901 ACACTTCTGCTGAAGCATTTTGG - Intergenic
939395594 2:141625244-141625266 ACATTTTTGCTGAATCATGTTGG - Intronic
939505346 2:143039168-143039190 TTATTTTTACTGAAGCATTTGGG - Intronic
939842838 2:147209357-147209379 ATAATTATACTGAAGAATATAGG + Intergenic
941237385 2:162992214-162992236 ACATTTGCATTGAAACATACAGG - Intergenic
943408396 2:187516492-187516514 ATACTTGTGCTGAAGCATTTTGG - Intronic
943683634 2:190793579-190793601 ACATTTGAACTGAAACTTAAGGG + Intergenic
945077979 2:206059414-206059436 CTATTTTTACTGTAGCATATAGG + Intronic
945289971 2:208117289-208117311 ACACTTGTGCTGAAGCATTTTGG - Intergenic
945334819 2:208579718-208579740 ACATTTGTAATGCAGAATATGGG - Intronic
946043451 2:216802335-216802357 TCCTTTGTTCTGAAGGATATAGG + Intergenic
947977909 2:234383682-234383704 ACATTTCTAGTGTAGAATATTGG - Intergenic
948711020 2:239825624-239825646 ACATTTGGACACAAGCAAATGGG + Intergenic
1168847164 20:953293-953315 ACACTTGTTCTGCAGCATGTGGG + Intergenic
1170400753 20:15980451-15980473 ACACTTGTGCTGAAGCATTTTGG + Intronic
1172769668 20:37373806-37373828 AAAGTTGTCCTGAAACATATGGG - Intronic
1174659049 20:52194604-52194626 ATTTTTGTACTGAAGAAAATGGG - Intronic
1175513518 20:59552136-59552158 ACACTTGTGCTGAAGGATTTTGG + Intergenic
1175658036 20:60789064-60789086 ACATTTGTACATCATCATATAGG - Intergenic
1177783849 21:25648353-25648375 AAAATTGTACCTAAGCATATTGG + Intronic
1178448142 21:32664183-32664205 ACACTTGCGCTGAAGCATTTTGG - Intronic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1179669485 21:42936390-42936412 ACACTTGTGCTGATGCATTTTGG - Intergenic
953004384 3:38964584-38964606 AGATTTAAACTGAAGCATAGAGG + Intergenic
955397319 3:58566457-58566479 ACATTTCTACAGAAGCAGGTGGG + Exonic
955974236 3:64465066-64465088 ACATCTGTACCGAACCTTATAGG - Intergenic
956996380 3:74830770-74830792 ACACTTGTGCTGAAGCATTTTGG - Intergenic
957406637 3:79780402-79780424 ACACTTGTGCTGAAGCATTTTGG - Intergenic
957999491 3:87734144-87734166 ACACTTGTGCTGAAGCATTCTGG + Intergenic
958626342 3:96628870-96628892 GCATTTTTACTGTGGCATATTGG - Intergenic
959026076 3:101241301-101241323 ACATTTGAACTGAGGCACATGGG + Intronic
959489679 3:106973416-106973438 ACATTTGGTCTGAAATATATGGG - Intergenic
962096340 3:132296637-132296659 ACACTTGTGCTGAAGCATTCTGG + Intergenic
962097780 3:132309828-132309850 ACACTTGTGCTGAAGCACTTTGG - Intergenic
963680484 3:148369268-148369290 ACATTTGTACTGAACTAGAAAGG - Intergenic
964932583 3:162045082-162045104 ACACTTGCGCTGAAGCATTTTGG + Intergenic
966158391 3:176943026-176943048 ACATTTCTGTTGAAGCATATTGG - Intergenic
967237157 3:187396629-187396651 ACATTTTTACAAGAGCATATGGG - Intergenic
969545585 4:7824962-7824984 TCATTAGTACTGAACAATATGGG + Intronic
972148239 4:36056092-36056114 ACAAATGTACTCAAGTATATTGG + Intronic
972217453 4:36912771-36912793 ACACTTGTGCTGAAGCATTTTGG - Intergenic
972275317 4:37551860-37551882 ACACTTGTGCTGAAGCATTTTGG - Intronic
974988311 4:69056733-69056755 ACACTTGTGCTGAAGCACTTTGG - Intronic
975904906 4:79197870-79197892 ACATTTGAGCTGAATCATAAAGG + Intergenic
977043136 4:92038997-92039019 ACACTTGTGCTAAAGCATTTTGG + Intergenic
977109075 4:92927929-92927951 ATATTAGCACTGAAGCATTTTGG - Intronic
978404732 4:108367265-108367287 TCATTTCTATGGAAGCATATAGG + Intergenic
979052841 4:115955924-115955946 ACACTTGCACTGAAGCATTTTGG - Intergenic
979937810 4:126719635-126719657 ACTTTAGTTCTGAATCATATAGG + Intergenic
980073428 4:128267112-128267134 ACATTTGTGCTGAAGCATTTTGG - Intergenic
980780576 4:137486459-137486481 ACCCTTGTGCTGAAGCATTTTGG - Intergenic
982447276 4:155507635-155507657 ACATTTATACATAAGGATATAGG - Intergenic
983048529 4:163015510-163015532 ACATTTATTCTGCAGCTTATAGG + Intergenic
984455879 4:179967163-179967185 TCATGTGTGCTGCAGCATATGGG - Intergenic
984919702 4:184752611-184752633 CCATTTGTACTGAAGCTTGGAGG + Intergenic
987382561 5:17299433-17299455 ACTTATGAACTGAAGCATTTCGG + Intergenic
989095619 5:37778619-37778641 ACATGTGTGCTGAAGCATTTTGG + Intergenic
989557983 5:42819200-42819222 ACACTTGTGCTGAAGCATTTTGG - Intronic
990080049 5:51901535-51901557 GCATTTGAACTGAAACATAATGG + Intergenic
990474233 5:56146074-56146096 TCATTTGCAATGAAGCAAATGGG - Intronic
990546854 5:56831040-56831062 ACATGACTACTTAAGCATATGGG - Intronic
990915370 5:60897179-60897201 ACATTTGGCCTGAAGGAAATGGG - Intronic
991507644 5:67342171-67342193 ACATTTGATCAGAAGAATATTGG + Intergenic
991659050 5:68932099-68932121 ACCTTTGAACTGAAGCACCTGGG + Intergenic
991675746 5:69088368-69088390 ACACTTGTGCTGAAGCATTTTGG + Intergenic
992989309 5:82267853-82267875 ACACTTGTGCTGAAGCATTTTGG + Intronic
993238014 5:85341027-85341049 ACATTTCTACCAAACCATATGGG + Intergenic
994720570 5:103375362-103375384 ACATTTCTACTGTAGAGTATTGG + Intergenic
995480179 5:112585420-112585442 CCATTTGTACTGAAGTCAATAGG + Intergenic
996755293 5:126928875-126928897 AAATTCATACTGAAGTATATAGG - Intronic
999557402 5:152758679-152758701 ACATTCCTACTAAATCATATTGG - Intergenic
1000237218 5:159373292-159373314 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1001262091 5:170239306-170239328 AAATTTTTCCTGAAGTATATTGG + Intronic
1001395151 5:171413684-171413706 ATATTTGTACTGAATACTATAGG + Intergenic
1001810893 5:174627485-174627507 ACATTTATACAGAAGCACACAGG + Intergenic
1002998696 6:2310964-2310986 ACATTTGTGCTGAAGCATTTTGG + Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1004258382 6:14085742-14085764 AGATTTGTCCTGAAGCAAATAGG - Intergenic
1004869736 6:19892808-19892830 ACATTTGAACTCAGGCATGTTGG - Intergenic
1005462355 6:26081189-26081211 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1005662461 6:28012979-28013001 ACATATGTACTGTAACATGTGGG - Intergenic
1005964304 6:30716194-30716216 ACATTTGAACTGAATCTTAAAGG - Intronic
1006570928 6:35003698-35003720 ACACTTGTGCTGAAGCATTTTGG - Intronic
1007512487 6:42384748-42384770 ACATTTGAACTGATGCGTATGGG - Intronic
1008960991 6:57265207-57265229 ACCTTTTTACTGAACCATGTGGG + Intergenic
1009510356 6:64543669-64543691 ACATTTGTAATCAAGAATTTTGG + Intronic
1009521874 6:64693238-64693260 ACATTTGGACTGAATCAATTGGG - Intronic
1009558099 6:65201735-65201757 ACATCTGTTCTGGACCATATAGG - Intronic
1010503608 6:76630171-76630193 ATATGTGAAATGAAGCATATAGG - Intergenic
1012282282 6:97342469-97342491 AAATTTGTATGGAAACATATGGG + Intergenic
1013558902 6:111284754-111284776 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1014735850 6:125095530-125095552 ACATTTCTAGAGTAGCATATTGG + Intergenic
1015079145 6:129202276-129202298 ACATTTGGACCATAGCATATAGG - Intronic
1015172346 6:130267378-130267400 ACACTTGTGCTGAAGCATTTTGG - Intronic
1015193430 6:130498002-130498024 ACATTTGTCCTGAATTATCTGGG - Intergenic
1015346540 6:132166408-132166430 TCATTGCTACTGAACCATATAGG - Intergenic
1015913080 6:138187628-138187650 ACATTTGGACTCAAGTTTATGGG - Intronic
1015918060 6:138238320-138238342 AAATTTGTTTTTAAGCATATAGG - Intronic
1017051992 6:150402013-150402035 ACATTAGAACTGGAGCATTTGGG - Exonic
1020043424 7:5021441-5021463 ACACTCGTGCTGAAGCATTTTGG + Intronic
1021849012 7:24789846-24789868 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1022054262 7:26713216-26713238 ACATTTAAACTGAAGCCTTTTGG - Intronic
1022339395 7:29454149-29454171 ACATTTGAACTGGATCATAAAGG + Intronic
1022490166 7:30811396-30811418 ACACTTGTGCTGAAGCATTTTGG - Intronic
1022614549 7:31915903-31915925 ACAGTTGTGCAGAAGTATATTGG + Intronic
1023219838 7:37908547-37908569 AAATTTCTACTGAAGTATATTGG + Intronic
1024312291 7:47980019-47980041 ACTTTGGTATTGAAGCATCTTGG + Intergenic
1029486605 7:100846603-100846625 ACACTTGTGCTGAAGCATTTTGG - Intronic
1031228188 7:119068853-119068875 ACATTTGTACATAAGAATATAGG + Intergenic
1032671957 7:134092041-134092063 ACCTTTGTTCTTAAGCATTTTGG + Intergenic
1032964064 7:137075110-137075132 ACAGGTGAACTGAAGAATATTGG + Intergenic
1032979246 7:137263101-137263123 ACACTTGTGCTGAAGCATTTTGG + Intronic
1033013185 7:137644186-137644208 AGATTTGTACTGATTCTTATTGG - Intronic
1039876580 8:41591539-41591561 ACACTTATGCTGAAGCATTTTGG + Intronic
1041227531 8:55715469-55715491 ACACTTGTGCTGAAGCATTTTGG - Intronic
1041515879 8:58698288-58698310 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1041993584 8:64025795-64025817 ACATTTCTTCTGAAACTTATGGG - Intergenic
1043982909 8:86661081-86661103 ACATTTTTACTGACTCATATGGG - Intronic
1047900524 8:129416619-129416641 ACATTTGAACTGAGTCATAAAGG + Intergenic
1048294013 8:133200967-133200989 ACATTTGCACTGAATCCTAAAGG - Intronic
1048298314 8:133232804-133232826 ACCTCTATCCTGAAGCATATTGG + Intergenic
1052189233 9:25638258-25638280 ATATATGTACTGAAGCAACTAGG + Intergenic
1053077586 9:35147330-35147352 ACATTTGTTCTCAAGTATAAAGG + Intergenic
1053429051 9:38029962-38029984 GCTGTTGTGCTGAAGCATATGGG - Intronic
1057087286 9:92222943-92222965 ACATTTGTACTGAAGTCTTCGGG - Intronic
1060082489 9:120663415-120663437 ACATTTGTGCGGAACCAGATAGG + Intronic
1185910391 X:3975605-3975627 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1188051339 X:25490820-25490842 ATATTTGTACTGATGCAAATTGG + Intergenic
1188264877 X:28060780-28060802 ACAATTGTACTGATCCAAATGGG - Intergenic
1189082236 X:37986738-37986760 ACACTTGTGCTGAAGCATTTTGG + Intronic
1190425407 X:50330560-50330582 ACACTTGTGCTGAAGCATTTTGG + Intronic
1190771709 X:53520193-53520215 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1191639626 X:63416111-63416133 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1192928321 X:75779315-75779337 ATATTTTTATGGAAGCATATGGG - Intergenic
1193565646 X:83073281-83073303 AAATTTGTGGTGAAGCTTATGGG - Intergenic
1193717764 X:84951900-84951922 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1193903456 X:87213236-87213258 ACATTTATACTTAAACAAATTGG - Intergenic
1194384810 X:93239063-93239085 ACACTTGTGCTGAAGCATTGTGG - Intergenic
1196422600 X:115538295-115538317 ACACTTTTGCTGAAGCATTTTGG + Intergenic
1196459638 X:115916999-115917021 ACACTTGTGCTAAAGCATTTTGG + Intergenic
1196869705 X:120101112-120101134 ACACCTGTGCTGAAGCATTTTGG - Intergenic
1199172674 X:144749858-144749880 ATATTTGTACAGCAGCACATGGG + Intergenic
1200393657 X:155969508-155969530 ACACTTGTGCTGAAGCATTTTGG + Intergenic
1200943772 Y:8811133-8811155 ACACTTGTGCTGAAGCATTTTGG - Intergenic
1201270728 Y:12251392-12251414 ACATTTGTACTGAAGCATTTTGG - Intergenic
1201362492 Y:13168142-13168164 ACACTTGTGCTGAAGTATTTTGG + Intergenic
1201373321 Y:13289129-13289151 ACACTTGTGCTGAAGCATTTTGG - Intronic
1201556642 Y:15269954-15269976 ACACTTGTGCTGATGCATTTTGG - Intergenic
1201680128 Y:16636652-16636674 ATATTTGTGCTGAAGCATTCTGG + Intergenic