ID: 1100686474

View in Genome Browser
Species Human (GRCh38)
Location 12:96991913-96991935
Sequence ATGCACATTGATCCGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100686464_1100686474 12 Left 1100686464 12:96991878-96991900 CCGTGCTCTCTCCCACCTCGTCC No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data
1100686465_1100686474 1 Left 1100686465 12:96991889-96991911 CCCACCTCGTCCCCACCAATAGC No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data
1100686467_1100686474 -3 Left 1100686467 12:96991893-96991915 CCTCGTCCCCACCAATAGCCATG No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data
1100686466_1100686474 0 Left 1100686466 12:96991890-96991912 CCACCTCGTCCCCACCAATAGCC No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data
1100686468_1100686474 -9 Left 1100686468 12:96991899-96991921 CCCCACCAATAGCCATGCACATT No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data
1100686469_1100686474 -10 Left 1100686469 12:96991900-96991922 CCCACCAATAGCCATGCACATTG No data
Right 1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100686474 Original CRISPR ATGCACATTGATCCGTTGGC TGG Intergenic
No off target data available for this crispr