ID: 1100687003

View in Genome Browser
Species Human (GRCh38)
Location 12:96997433-96997455
Sequence CCACCAACACCAACTACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100687003_1100687007 12 Left 1100687003 12:96997433-96997455 CCAATGGTAGTTGGTGTTGGTGG No data
Right 1100687007 12:96997468-96997490 ACATACTCATTCGAGTACCTGGG No data
1100687003_1100687009 29 Left 1100687003 12:96997433-96997455 CCAATGGTAGTTGGTGTTGGTGG No data
Right 1100687009 12:96997485-96997507 CCTGGGCTATTTCTGTCCTGTGG No data
1100687003_1100687006 11 Left 1100687003 12:96997433-96997455 CCAATGGTAGTTGGTGTTGGTGG No data
Right 1100687006 12:96997467-96997489 CACATACTCATTCGAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100687003 Original CRISPR CCACCAACACCAACTACCAT TGG (reversed) Intergenic
No off target data available for this crispr