ID: 1100687007

View in Genome Browser
Species Human (GRCh38)
Location 12:96997468-96997490
Sequence ACATACTCATTCGAGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100687000_1100687007 20 Left 1100687000 12:96997425-96997447 CCCACAATCCAATGGTAGTTGGT No data
Right 1100687007 12:96997468-96997490 ACATACTCATTCGAGTACCTGGG No data
1100687003_1100687007 12 Left 1100687003 12:96997433-96997455 CCAATGGTAGTTGGTGTTGGTGG No data
Right 1100687007 12:96997468-96997490 ACATACTCATTCGAGTACCTGGG No data
1100687001_1100687007 19 Left 1100687001 12:96997426-96997448 CCACAATCCAATGGTAGTTGGTG No data
Right 1100687007 12:96997468-96997490 ACATACTCATTCGAGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100687007 Original CRISPR ACATACTCATTCGAGTACCT GGG Intergenic
No off target data available for this crispr