ID: 1100688712

View in Genome Browser
Species Human (GRCh38)
Location 12:97015081-97015103
Sequence TTACCTGCATACTTTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100688712_1100688717 1 Left 1100688712 12:97015081-97015103 CCACCACTAAAGTATGCAGGTAA No data
Right 1100688717 12:97015105-97015127 AGGGTGGACGATCAGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100688712 Original CRISPR TTACCTGCATACTTTAGTGG TGG (reversed) Intergenic
No off target data available for this crispr