ID: 1100692378

View in Genome Browser
Species Human (GRCh38)
Location 12:97052117-97052139
Sequence GGGTCTTTCTTGCAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100692373_1100692378 17 Left 1100692373 12:97052077-97052099 CCAAACTATATTTATGCGATATT No data
Right 1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100692378 Original CRISPR GGGTCTTTCTTGCAGTATGA AGG Intergenic
No off target data available for this crispr