ID: 1100692955

View in Genome Browser
Species Human (GRCh38)
Location 12:97058454-97058476
Sequence GGGTGGCCCTAGGATCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100692955_1100692961 6 Left 1100692955 12:97058454-97058476 CCCAGTGGATCCTAGGGCCACCC No data
Right 1100692961 12:97058483-97058505 TGATGTCAGTGATAATCATCAGG No data
1100692955_1100692964 27 Left 1100692955 12:97058454-97058476 CCCAGTGGATCCTAGGGCCACCC No data
Right 1100692964 12:97058504-97058526 GGGGTGAAACAGAGTACAAGTGG No data
1100692955_1100692962 7 Left 1100692955 12:97058454-97058476 CCCAGTGGATCCTAGGGCCACCC No data
Right 1100692962 12:97058484-97058506 GATGTCAGTGATAATCATCAGGG No data
1100692955_1100692963 8 Left 1100692955 12:97058454-97058476 CCCAGTGGATCCTAGGGCCACCC No data
Right 1100692963 12:97058485-97058507 ATGTCAGTGATAATCATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100692955 Original CRISPR GGGTGGCCCTAGGATCCACT GGG (reversed) Intergenic
No off target data available for this crispr