ID: 1100708614

View in Genome Browser
Species Human (GRCh38)
Location 12:97229044-97229066
Sequence CTGTGAGGCCCTTCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100708611_1100708614 -10 Left 1100708611 12:97229031-97229053 CCCTTTTCATGGCCTGTGAGGCC No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data
1100708605_1100708614 14 Left 1100708605 12:97229007-97229029 CCTAACACCTGCTCCCTATGTAA No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data
1100708609_1100708614 0 Left 1100708609 12:97229021-97229043 CCTATGTAAACCCTTTTCATGGC No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data
1100708606_1100708614 7 Left 1100708606 12:97229014-97229036 CCTGCTCCCTATGTAAACCCTTT No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data
1100708607_1100708614 1 Left 1100708607 12:97229020-97229042 CCCTATGTAAACCCTTTTCATGG No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data
1100708604_1100708614 21 Left 1100708604 12:97229000-97229022 CCAATTACCTAACACCTGCTCCC No data
Right 1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100708614 Original CRISPR CTGTGAGGCCCTTCATCACC TGG Intergenic
No off target data available for this crispr