ID: 1100708677

View in Genome Browser
Species Human (GRCh38)
Location 12:97229809-97229831
Sequence CTGGTGTTCTTAAGCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100708677_1100708681 3 Left 1100708677 12:97229809-97229831 CCTTCTGTGCTTAAGAACACCAG No data
Right 1100708681 12:97229835-97229857 GCACTTCAGCACTATACTTGGGG No data
1100708677_1100708680 2 Left 1100708677 12:97229809-97229831 CCTTCTGTGCTTAAGAACACCAG No data
Right 1100708680 12:97229834-97229856 AGCACTTCAGCACTATACTTGGG No data
1100708677_1100708679 1 Left 1100708677 12:97229809-97229831 CCTTCTGTGCTTAAGAACACCAG No data
Right 1100708679 12:97229833-97229855 CAGCACTTCAGCACTATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100708677 Original CRISPR CTGGTGTTCTTAAGCACAGA AGG (reversed) Intergenic
No off target data available for this crispr