ID: 1100710986

View in Genome Browser
Species Human (GRCh38)
Location 12:97256849-97256871
Sequence TGCCTTGAGGAGCACGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100710986_1100710989 -8 Left 1100710986 12:97256849-97256871 CCTTCACCGTGCTCCTCAAGGCA No data
Right 1100710989 12:97256864-97256886 TCAAGGCACCTTACCATCCCTGG No data
1100710986_1100710991 2 Left 1100710986 12:97256849-97256871 CCTTCACCGTGCTCCTCAAGGCA No data
Right 1100710991 12:97256874-97256896 TTACCATCCCTGGTCAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100710986 Original CRISPR TGCCTTGAGGAGCACGGTGA AGG (reversed) Intergenic
No off target data available for this crispr