ID: 1100714955

View in Genome Browser
Species Human (GRCh38)
Location 12:97295819-97295841
Sequence TCATGCCTACAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100714955_1100714959 7 Left 1100714955 12:97295819-97295841 CCTTCCTCATGCTGTAGGCATGA No data
Right 1100714959 12:97295849-97295871 TAATTCTCCCTTTAGTCTGGAGG No data
1100714955_1100714963 19 Left 1100714955 12:97295819-97295841 CCTTCCTCATGCTGTAGGCATGA No data
Right 1100714963 12:97295861-97295883 TAGTCTGGAGGGAGATGTTCTGG No data
1100714955_1100714964 30 Left 1100714955 12:97295819-97295841 CCTTCCTCATGCTGTAGGCATGA No data
Right 1100714964 12:97295872-97295894 GAGATGTTCTGGTATGTCCCAGG No data
1100714955_1100714960 8 Left 1100714955 12:97295819-97295841 CCTTCCTCATGCTGTAGGCATGA No data
Right 1100714960 12:97295850-97295872 AATTCTCCCTTTAGTCTGGAGGG No data
1100714955_1100714958 4 Left 1100714955 12:97295819-97295841 CCTTCCTCATGCTGTAGGCATGA No data
Right 1100714958 12:97295846-97295868 CCTTAATTCTCCCTTTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100714955 Original CRISPR TCATGCCTACAGCATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr