ID: 1100715202

View in Genome Browser
Species Human (GRCh38)
Location 12:97298348-97298370
Sequence CAGCTGTTCTGGAGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100715198_1100715202 11 Left 1100715198 12:97298314-97298336 CCTTCATGCACTGCAGGGTGAAG No data
Right 1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100715202 Original CRISPR CAGCTGTTCTGGAGGGAATA TGG Intergenic
No off target data available for this crispr