ID: 1100718394

View in Genome Browser
Species Human (GRCh38)
Location 12:97329455-97329477
Sequence CTGTGGGATTGGAGGAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100718385_1100718394 4 Left 1100718385 12:97329428-97329450 CCTTAAACAAGAGGAGGATGCCT No data
Right 1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100718394 Original CRISPR CTGTGGGATTGGAGGAAAGG TGG Intergenic
No off target data available for this crispr