ID: 1100726106

View in Genome Browser
Species Human (GRCh38)
Location 12:97410630-97410652
Sequence ATCTGATGGAAGCAGTAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100726106_1100726112 14 Left 1100726106 12:97410630-97410652 CCCTATTACTGCTTCCATCAGAT No data
Right 1100726112 12:97410667-97410689 CACTTTCTGGATCTCCCATGTGG No data
1100726106_1100726109 1 Left 1100726106 12:97410630-97410652 CCCTATTACTGCTTCCATCAGAT No data
Right 1100726109 12:97410654-97410676 TCATTCCAGCAGCCACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100726106 Original CRISPR ATCTGATGGAAGCAGTAATA GGG (reversed) Intergenic
No off target data available for this crispr