ID: 1100734780

View in Genome Browser
Species Human (GRCh38)
Location 12:97514252-97514274
Sequence CCAGATGACAACATCCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100734777_1100734780 5 Left 1100734777 12:97514224-97514246 CCTACGAAAGCTCAGAGGCAACA No data
Right 1100734780 12:97514252-97514274 CCAGATGACAACATCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100734780 Original CRISPR CCAGATGACAACATCCTTAT GGG Intergenic
No off target data available for this crispr