ID: 1100738193

View in Genome Browser
Species Human (GRCh38)
Location 12:97561674-97561696
Sequence CTCTGAATGAGCAGCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100738193_1100738195 9 Left 1100738193 12:97561674-97561696 CCTTGGTGGCTGCTCATTCAGAG No data
Right 1100738195 12:97561706-97561728 TCCATCCCAGCTCCGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100738193 Original CRISPR CTCTGAATGAGCAGCCACCA AGG (reversed) Intergenic
No off target data available for this crispr