ID: 1100739830

View in Genome Browser
Species Human (GRCh38)
Location 12:97579777-97579799
Sequence CTCTATCAGAAGAGGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100739826_1100739830 -1 Left 1100739826 12:97579755-97579777 CCAGACTATTAATTAAAACCTCC No data
Right 1100739830 12:97579777-97579799 CTCTATCAGAAGAGGATACAAGG No data
1100739825_1100739830 0 Left 1100739825 12:97579754-97579776 CCCAGACTATTAATTAAAACCTC No data
Right 1100739830 12:97579777-97579799 CTCTATCAGAAGAGGATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100739830 Original CRISPR CTCTATCAGAAGAGGATACA AGG Intergenic
No off target data available for this crispr