ID: 1100741711

View in Genome Browser
Species Human (GRCh38)
Location 12:97601015-97601037
Sequence CCTGTTAGACATCAGGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100741711_1100741714 27 Left 1100741711 12:97601015-97601037 CCACTATCCTGATGTCTAACAGG No data
Right 1100741714 12:97601065-97601087 TTTTGTATAAATATAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100741711 Original CRISPR CCTGTTAGACATCAGGATAG TGG (reversed) Intergenic
No off target data available for this crispr