ID: 1100741714

View in Genome Browser
Species Human (GRCh38)
Location 12:97601065-97601087
Sequence TTTTGTATAAATATAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100741711_1100741714 27 Left 1100741711 12:97601015-97601037 CCACTATCCTGATGTCTAACAGG No data
Right 1100741714 12:97601065-97601087 TTTTGTATAAATATAATCAATGG No data
1100741713_1100741714 20 Left 1100741713 12:97601022-97601044 CCTGATGTCTAACAGGAAGATTC No data
Right 1100741714 12:97601065-97601087 TTTTGTATAAATATAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100741714 Original CRISPR TTTTGTATAAATATAATCAA TGG Intergenic
No off target data available for this crispr