ID: 1100741801

View in Genome Browser
Species Human (GRCh38)
Location 12:97602092-97602114
Sequence TGCCTTGTGCACTCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100741801_1100741804 -5 Left 1100741801 12:97602092-97602114 CCTCAGTGTGAGTGCACAAGGCA No data
Right 1100741804 12:97602110-97602132 AGGCAACGGTTATTATATAAGGG No data
1100741801_1100741805 15 Left 1100741801 12:97602092-97602114 CCTCAGTGTGAGTGCACAAGGCA No data
Right 1100741805 12:97602130-97602152 GGGCCTCCCAAGTTCAAGAATGG No data
1100741801_1100741803 -6 Left 1100741801 12:97602092-97602114 CCTCAGTGTGAGTGCACAAGGCA No data
Right 1100741803 12:97602109-97602131 AAGGCAACGGTTATTATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100741801 Original CRISPR TGCCTTGTGCACTCACACTG AGG (reversed) Intergenic
No off target data available for this crispr