ID: 1100749448

View in Genome Browser
Species Human (GRCh38)
Location 12:97680944-97680966
Sequence GGACTTGTTAAGATTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100749448_1100749452 7 Left 1100749448 12:97680944-97680966 CCTTCTTTAATCTTAACAAGTCC No data
Right 1100749452 12:97680974-97680996 CCTTATCAGCTCAGCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100749448 Original CRISPR GGACTTGTTAAGATTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr