ID: 1100756398

View in Genome Browser
Species Human (GRCh38)
Location 12:97755895-97755917
Sequence AACTGATGTTAGGAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100756395_1100756398 -8 Left 1100756395 12:97755880-97755902 CCCACAAAGCATTTAAACTGATG No data
Right 1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG No data
1100756396_1100756398 -9 Left 1100756396 12:97755881-97755903 CCACAAAGCATTTAAACTGATGT No data
Right 1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG No data
1100756394_1100756398 5 Left 1100756394 12:97755867-97755889 CCTAATCATTATACCCACAAAGC No data
Right 1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100756398 Original CRISPR AACTGATGTTAGGAGAATGA TGG Intergenic
No off target data available for this crispr