ID: 1100757059

View in Genome Browser
Species Human (GRCh38)
Location 12:97763115-97763137
Sequence GTTTAAATTAGCTGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100757059_1100757067 22 Left 1100757059 12:97763115-97763137 CCAGCCTCCCAGCTAATTTAAAC No data
Right 1100757067 12:97763160-97763182 GCTCTGTCCTTTTTCTTGTCGGG No data
1100757059_1100757066 21 Left 1100757059 12:97763115-97763137 CCAGCCTCCCAGCTAATTTAAAC No data
Right 1100757066 12:97763159-97763181 TGCTCTGTCCTTTTTCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100757059 Original CRISPR GTTTAAATTAGCTGGGAGGC TGG (reversed) Intergenic