ID: 1100759081

View in Genome Browser
Species Human (GRCh38)
Location 12:97786360-97786382
Sequence GCCCATCTGGTCATTCTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100759076_1100759081 25 Left 1100759076 12:97786312-97786334 CCAAAAAATCTCATAATTCACAT No data
Right 1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG No data
1100759077_1100759081 -6 Left 1100759077 12:97786343-97786365 CCAACCCAGAGCTACTTGCCCAT No data
Right 1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG No data
1100759078_1100759081 -10 Left 1100759078 12:97786347-97786369 CCCAGAGCTACTTGCCCATCTGG No data
Right 1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100759081 Original CRISPR GCCCATCTGGTCATTCTTAT AGG Intergenic
No off target data available for this crispr