ID: 1100761537

View in Genome Browser
Species Human (GRCh38)
Location 12:97812604-97812626
Sequence CTGGAATGCTAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100761533_1100761537 -2 Left 1100761533 12:97812583-97812605 CCTCAGCTTGTGGGTCAGCTGCT No data
Right 1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100761537 Original CRISPR CTGGAATGCTAGAGGGAAGA TGG Intergenic
No off target data available for this crispr