ID: 1100765947

View in Genome Browser
Species Human (GRCh38)
Location 12:97865820-97865842
Sequence CTGGGGGGATAGATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100765947_1100765956 10 Left 1100765947 12:97865820-97865842 CCCTCCTCAATCTATCCCCCCAG No data
Right 1100765956 12:97865853-97865875 TTACTTTTGCCTCTTCAAACTGG No data
1100765947_1100765957 11 Left 1100765947 12:97865820-97865842 CCCTCCTCAATCTATCCCCCCAG No data
Right 1100765957 12:97865854-97865876 TACTTTTGCCTCTTCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100765947 Original CRISPR CTGGGGGGATAGATTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr