ID: 1100767752

View in Genome Browser
Species Human (GRCh38)
Location 12:97886547-97886569
Sequence CCCAAGGAAAAAAATTACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100767752_1100767756 19 Left 1100767752 12:97886547-97886569 CCTCGGTAATTTTTTTCCTTGGG No data
Right 1100767756 12:97886589-97886611 TGAAAGTACATCTGCAGAAATGG No data
1100767752_1100767757 30 Left 1100767752 12:97886547-97886569 CCTCGGTAATTTTTTTCCTTGGG No data
Right 1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100767752 Original CRISPR CCCAAGGAAAAAAATTACCG AGG (reversed) Intergenic
No off target data available for this crispr