ID: 1100767755

View in Genome Browser
Species Human (GRCh38)
Location 12:97886563-97886585
Sequence ATTGAGATTCCTATTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100767755_1100767758 15 Left 1100767755 12:97886563-97886585 CCTTGGGAAATAGGAATCTCAAT No data
Right 1100767758 12:97886601-97886623 TGCAGAAATGGTAAGCATATGGG No data
1100767755_1100767756 3 Left 1100767755 12:97886563-97886585 CCTTGGGAAATAGGAATCTCAAT No data
Right 1100767756 12:97886589-97886611 TGAAAGTACATCTGCAGAAATGG No data
1100767755_1100767759 16 Left 1100767755 12:97886563-97886585 CCTTGGGAAATAGGAATCTCAAT No data
Right 1100767759 12:97886602-97886624 GCAGAAATGGTAAGCATATGGGG No data
1100767755_1100767757 14 Left 1100767755 12:97886563-97886585 CCTTGGGAAATAGGAATCTCAAT No data
Right 1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100767755 Original CRISPR ATTGAGATTCCTATTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr