ID: 1100767757

View in Genome Browser
Species Human (GRCh38)
Location 12:97886600-97886622
Sequence CTGCAGAAATGGTAAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100767755_1100767757 14 Left 1100767755 12:97886563-97886585 CCTTGGGAAATAGGAATCTCAAT No data
Right 1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG No data
1100767752_1100767757 30 Left 1100767752 12:97886547-97886569 CCTCGGTAATTTTTTTCCTTGGG No data
Right 1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100767757 Original CRISPR CTGCAGAAATGGTAAGCATA TGG Intergenic
No off target data available for this crispr