ID: 1100767862

View in Genome Browser
Species Human (GRCh38)
Location 12:97887530-97887552
Sequence CTCCAAAACCAGGCAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100767858_1100767862 13 Left 1100767858 12:97887494-97887516 CCAAGGGCACAGAGATAGTAAAT No data
Right 1100767862 12:97887530-97887552 CTCCAAAACCAGGCAGGCTCTGG No data
1100767857_1100767862 14 Left 1100767857 12:97887493-97887515 CCCAAGGGCACAGAGATAGTAAA No data
Right 1100767862 12:97887530-97887552 CTCCAAAACCAGGCAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100767862 Original CRISPR CTCCAAAACCAGGCAGGCTC TGG Intergenic
No off target data available for this crispr