ID: 1100774862

View in Genome Browser
Species Human (GRCh38)
Location 12:97962810-97962832
Sequence GCTGTGAAGTAGGAACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100774862_1100774864 9 Left 1100774862 12:97962810-97962832 CCAGACTGTTCCTACTTCACAGC No data
Right 1100774864 12:97962842-97962864 AGTTCCTGATGCCCAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100774862 Original CRISPR GCTGTGAAGTAGGAACAGTC TGG (reversed) Intergenic
No off target data available for this crispr