ID: 1100779384

View in Genome Browser
Species Human (GRCh38)
Location 12:98007959-98007981
Sequence CCCAGGCTGGAGTACAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12450
Summary {0: 23, 1: 86, 2: 604, 3: 7112, 4: 4625}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100779384_1100779398 28 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779398 12:98008010-98008032 AGGAGAAGGAGAAGGGGAAAGGG No data
1100779384_1100779396 22 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779396 12:98008004-98008026 AGAAGAAGGAGAAGGAGAAGGGG 0: 31
1: 125
2: 784
3: 2180
4: 6947
1100779384_1100779390 -9 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779390 12:98007973-98007995 CAGCCTGGGTGGGAGAGTGAGGG No data
1100779384_1100779392 8 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779392 12:98007990-98008012 TGAGGGAGAAAAGAAGAAGAAGG No data
1100779384_1100779397 27 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG No data
1100779384_1100779394 20 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779394 12:98008002-98008024 GAAGAAGAAGGAGAAGGAGAAGG 0: 210
1: 1039
2: 2175
3: 5121
4: 13989
1100779384_1100779393 14 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779393 12:98007996-98008018 AGAAAAGAAGAAGAAGGAGAAGG 0: 13
1: 57
2: 483
3: 2045
4: 8168
1100779384_1100779395 21 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG No data
1100779384_1100779389 -10 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779389 12:98007972-98007994 CCAGCCTGGGTGGGAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100779384 Original CRISPR CCCAGGCTGGAGTACAGCAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr