ID: 1100779391

View in Genome Browser
Species Human (GRCh38)
Location 12:98007976-98007998
Sequence TCTCCCTCACTCTCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100779391_1100779399 17 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779399 12:98008016-98008038 AGGAGAAGGGGAAAGGGAAGAGG No data
1100779391_1100779402 23 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779402 12:98008022-98008044 AGGGGAAAGGGAAGAGGAAGGGG No data
1100779391_1100779393 -3 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779393 12:98007996-98008018 AGAAAAGAAGAAGAAGGAGAAGG 0: 13
1: 57
2: 483
3: 2045
4: 8168
1100779391_1100779401 22 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779401 12:98008021-98008043 AAGGGGAAAGGGAAGAGGAAGGG No data
1100779391_1100779400 21 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779400 12:98008020-98008042 GAAGGGGAAAGGGAAGAGGAAGG No data
1100779391_1100779404 28 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779404 12:98008027-98008049 AAAGGGAAGAGGAAGGGGAAGGG 0: 4
1: 69
2: 501
3: 1420
4: 4880
1100779391_1100779398 11 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779398 12:98008010-98008032 AGGAGAAGGAGAAGGGGAAAGGG No data
1100779391_1100779403 27 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779403 12:98008026-98008048 GAAAGGGAAGAGGAAGGGGAAGG 0: 5
1: 62
2: 501
3: 1809
4: 6621
1100779391_1100779405 29 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779405 12:98008028-98008050 AAGGGAAGAGGAAGGGGAAGGGG 0: 8
1: 90
2: 459
3: 1588
4: 5717
1100779391_1100779392 -9 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779392 12:98007990-98008012 TGAGGGAGAAAAGAAGAAGAAGG No data
1100779391_1100779397 10 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG No data
1100779391_1100779396 5 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779396 12:98008004-98008026 AGAAGAAGGAGAAGGAGAAGGGG 0: 31
1: 125
2: 784
3: 2180
4: 6947
1100779391_1100779395 4 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG No data
1100779391_1100779394 3 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779394 12:98008002-98008024 GAAGAAGAAGGAGAAGGAGAAGG 0: 210
1: 1039
2: 2175
3: 5121
4: 13989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100779391 Original CRISPR TCTCCCTCACTCTCCCACCC AGG (reversed) Intergenic
No off target data available for this crispr