ID: 1100779395

View in Genome Browser
Species Human (GRCh38)
Location 12:98008003-98008025
Sequence AAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100779391_1100779395 4 Left 1100779391 12:98007976-98007998 CCTGGGTGGGAGAGTGAGGGAGA No data
Right 1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG No data
1100779384_1100779395 21 Left 1100779384 12:98007959-98007981 CCACTGCTGTACTCCAGCCTGGG 0: 23
1: 86
2: 604
3: 7112
4: 4625
Right 1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG No data
1100779388_1100779395 8 Left 1100779388 12:98007972-98007994 CCAGCCTGGGTGGGAGAGTGAGG No data
Right 1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100779395 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr