ID: 1100783327

View in Genome Browser
Species Human (GRCh38)
Location 12:98052645-98052667
Sequence GTGTAAGCCCAGATATGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100783327_1100783331 18 Left 1100783327 12:98052645-98052667 CCCACACATATCTGGGCTTACAC No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100783327 Original CRISPR GTGTAAGCCCAGATATGTGT GGG (reversed) Intergenic
No off target data available for this crispr