ID: 1100783331

View in Genome Browser
Species Human (GRCh38)
Location 12:98052686-98052708
Sequence TTGAGCAAAAATGAACACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100783330_1100783331 -9 Left 1100783330 12:98052672-98052694 CCATTGCATGAAACTTGAGCAAA No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data
1100783323_1100783331 28 Left 1100783323 12:98052635-98052657 CCACTTGCTCCCCACACATATCT No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data
1100783329_1100783331 -8 Left 1100783329 12:98052671-98052693 CCCATTGCATGAAACTTGAGCAA No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data
1100783327_1100783331 18 Left 1100783327 12:98052645-98052667 CCCACACATATCTGGGCTTACAC No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data
1100783328_1100783331 17 Left 1100783328 12:98052646-98052668 CCACACATATCTGGGCTTACACT No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data
1100783326_1100783331 19 Left 1100783326 12:98052644-98052666 CCCCACACATATCTGGGCTTACA No data
Right 1100783331 12:98052686-98052708 TTGAGCAAAAATGAACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100783331 Original CRISPR TTGAGCAAAAATGAACACGA AGG Intergenic
No off target data available for this crispr